assuming the market for apples is perfectly competitive, what market price would result in a normal profit?

Answers

Answer 1

In a perfectly competitive market, the price of a product is determined by the intersection of supply and demand. In the case of apples, if the market is perfectly competitive, the price of apples would be such that it would result in normal profit for the producers.

Normal profit, also known as economic profit, is the minimum level of profit required by a firm to continue operating in the long run. It is the amount of profit that is just enough to cover all of the costs of production, including the opportunity cost of the resources used, such as labor and capital.

In a perfectly competitive market, firms are price takers, meaning they have no market power to influence the price of the product. Therefore, if the price of apples were to exceed the cost of production, new firms would enter the market to take advantage of the profit opportunity, leading to an increase in supply and a decrease in the price of apples. Conversely, if the price of apples were to fall below the cost of production, firms would exit the market, leading to a decrease in supply and an increase in the price of apples.

Therefore, in a perfectly competitive market, the market price that would result in a normal profit would be the price at which the average total cost of production is equal to the market price. At this price, firms would be able to cover all their costs, including the opportunity cost of their resources, and earn a normal profit.

In conclusion, in a perfectly competitive market, the market price of apples would be such that it would result in normal profit, which is the minimum level of profit required to keep the firm operating in the long run.

To know more about competitive market, refer here

https://brainly.com/question/29407851#

#SPJ11


Related Questions

Whether a purely competitive industry is a constant-cost industry or an increasing-cost industry, the final long-run equilibrium position of all competitive firms share which of the following characteristics

Answers

The correct answer is: In the long run, a multiple equality occurs where price is equal to marginal cost which is equal to minimum average total cost.

What does the long-run equilibrium position look like in a purely competitive market?

It occurs when companies are reaching zero economic profit and when there is no insertion of new companies in the sector. This occurs when, in the long run, companies produce at the minimum point of their average cost curve.

Therefore, in a long-term equilibrium situation in a competitive sector, production is adjusted to the minimum point of its average cost curve, where companies obtain only normal profits and not impacted by changes in demand, for example.

Find out more about long-run equilibrium here:

https://brainly.com/question/6275304

#SPJ1

Funds that are left over after you have paid for the necessities of food, clothing, and shelter are called ____________________________ Group of answer choices

Answers

Funds that are left over after you have paid for the necessities of food, clothing, and shelter are called discretionary funds.

What is discretionary funds?

These are funds, often considered not be necessary at the moment but are somewhat useful.

It is to be noted that discretionary funding is not essential for a person to live. A typical example is vacation.

Discretionary funds are often defined as nonessential spending. This means a business or household is still able to maintain itself even if all discretionary consumer spending stops.

Learn more about discretionary funds here: https://brainly.com/question/780448

#SPJ1

In which type of organizational commitment does an employee choose to remain with the organization because of a feeling of obligation to do so?

Answers

The type of organizational commitment an employee chooses to remain with the organization because of a feeling of obligation to do so is b. normative.

Regularly, they conclude they need to stay with a company due to the fact their advantages or destiny possibilities depend on their modern-day employment. As an example, an employee would possibly live with a corporation long time to obtain retirement advantages.

In organizational conduct and industrial and organizational psychology, organizational dedication is a person's psychological attachment to the corporation. Organizational scientists have also developed many nuanced definitions of organizational dedication, and several scales to measure them.

Organizational dedication refers to the relationship or bond employees have with their company (the company). That is based on commercial-organizational psychology and describes the man or woman's mental attachment to the organization.

The question is incomplete. Please read below to find the missing content.

In which type of organizational commitment does an employee choose to remain with the organization because of a feeling of obligation to do so?

a. continuance

b. normative

c. affective

d. associative

Learn more about organizational commitment here https://brainly.com/question/17924299

#SPJ4

Suppose there is an increase in taxes of $20. if the mpc equals 0.75, consumption will by $________ .

Answers

Suppose there is an increase in taxes by $20. If the MPC equals to 0.75, consumption will decrease by $15.

Consumption function:

C = c + MPC (Y - T)

Where C is consumption

c is autthe onomous consumption

MPC is marginal propensity to consume.

Y is income

T is taxes.

C = c + MPC (Y-T)

=> C = c + 0.75 (Y-T)

Differentiate C w.r.t T

=> ΔC / ΔT = -0.75   --------------(1)

Taxes increase by $20

=> ΔT = $20    ------------------(2)

Substitute (2) in (1)

=> ΔC / ΔT = -0.75

=> ΔC / $20 = -0.75

=> ΔC = -0.75 * $20

=> ΔC = -$15

The consumption will decrease by $15 if taxes increase by $20.

Consumption function, in economics, the relationship between consumer spending and the various factors that determine it. At the household or family level, these factors may include income, wealth, expectations regarding future income or wealth levels and risks, interest rates, age, education, and family size.

Learn more about Consumption here: https://brainly.com/question/25623677

#SPJ1

What best indicates that u.s. businesses are demanding socially responsible behavior from their international suppliers?

Answers

Decision of Nike to cancel orders from suppliers that violates its ethics code is the correct answer. A code of ethics is a set of principles designed to help professionals conduct business in an honest and ethical manner.

A code of ethics document may outline business or organization's mission and values, how professionals are expected to approach problems, ethical principles based on the organization's core values, and the standards to which the professional is held.

A compliance-based code of ethics, a value-based code of ethics, and a code of ethics among professionals are three main types of codes of ethics.

To learn more about ethics, click here

https://brainly.com/question/14914455

#SPJ4

In Year 8, Emil Gow won $5,000 in a state lottery. Also in Year 8, Emil spent $400 for the purchase of lottery tickets. Emil elected the standard deduction on his Year 8 income tax return. The amount of lottery winnings that should be included in Emil's Year 8 taxable income is

Answers

The amount of lottery winnings that should be included in Emil's Year 8 taxable income is: $5,000.

What is taxable income?

Taxable income can be defined as the income that are reduce by tax or other deduction.

Since we were told that the amount of $5,000 was won in the state lottery, which means that the amount of lottery winnings that should be included in Year 8 taxable income is will be the total or the whole amount of the gambling winnings which is $5,000.

Learn more about Taxable income here:https://brainly.com/question/26316390

#SPJ1

When a company targets several different market segments and creates a different marketing mix for each segment, they are using _______.

Answers

When a company targets several different market segments and creates a different marketing mix for each segment, they are using "multi-segment targeting".

What is multi-segment targeting?

A marketing tactic known as "multiple-segment specialisation" separates your target market into many groups made up of customers with comparable lifestyles and purchasing habits.

As a result, you might design advertisements that are specifically tailored to each demographic.

The multi segment target strategy is-

The company targets multiple market groups at once using a multi-segment targeting strategy, often known as a "differentiated marketing strategy," offering each segment unique advantages, a unique marketing mix, and unique marketing methods.Marketers frequently decide to concentrate on particular needs, such as convenience, affordability, quality, or individualized service. When businesses create a product that will be marketed to more than one sector, it is made to address a need that is present across all intended audiences.Some businesses will make rival items with various perceived benefits in order to develop a multi-segment targeting approach.

To know more about the Market Segmentation, here

https://brainly.com/question/15357678

#SPJ4

In the market for cell phones, if the supply of cell phones increases what will happen to the price and quantity of cell phones?.

Answers

If the supply of cell phones increases, the price of cell phones will reduce and the quantity of cell phones would increase.

What is the impact of an increase in the price of cell phones?

When the market of a good is in equilibrium and the supply for a good increases, the supply curve would shift to the right while the demand curve remains unchanged.

At the new equilibrium of the supply curve and the demand curve, price would be lower and quantity would be higher.

To learn more about an increase in supply, please check: https://brainly.com/question/14727864

#SPJ1

Using money as a medium of exchange is more efficient than barter because?

Answers

Explanation:

People are less likely to be cheated since the the object and money are often the same value, but with barter trade,an apple which may cost 5 dollars may be traded for a bag of rice which may cost 30 dollars

What jobs should require personality tests prior to hiring a candidate?

Answers

The first thing you need to understand is that personality test results alone cannot be used to hire employees. First, candidates must be assessed for cognitive ability.

Cognitive ability alone predicts more than 60% of the variation in job performance. Of all personality traits, none predict performance variability greater than 5%. Use the validity studies conducted on personality tests as a guide. Before deciding which roles require character assessment, determine which roles may suffer significantly when hiring someone with character flaws. Personality tests are very useful when used properly.

Personality tests are very dangerous in recruitment as almost all are of some degree of dubious validity and can lead to lawsuits and discrimination complaints. However, we assume that there are methods for assessing personality suitability for different types of jobs and that tests, combinations of tests, etc., can be developed to assess personality in combination with structured interviews and other assessment tools. increase.

learn more about personality test here: https://brainly.com/question/14297816

#SPJ4

Explain how fords vision can be used to advance innovation and integrate the engineers and the information technology professionals (i.e. encourage, facilitate collaboration, working in teams)

Answers

Fords vision can be used to advance innovation and integrate the engineers and the information technology professionals (i.e. encourage, facilitate collaboration, working in teams) in the given following ways.

What is Fords vision?

Ford's mission statement, which it now refers to as its vision, is effective in its clarity: "People working together as a lean, global company to improve people's lives through automotive and mobility leadership.

Ford's philosophy states that-

Ford's guiding principle was American economic independence. The River Rouge Plant of Ford would grow to be the largest industrial complex in the world, capable of making its own steel. Ford wanted to build a car from the ground up without depending on imports.Ford's market-oriented pricing approach is to set prices that are reasonable for the circumstances, taking into account factors such as competition, demand, consumer perception, and other factors.For the majority of its goods, including sedans and trucks, Ford uses this pricing strategy.

Ford make ethics an important part of its culture as-

The corporation has tight rules for conducting business internationally, maintains strict control over its foreign activities, and offers its staff an online global ethics training program that is available in 13 different languages. Despite having a strong Code of Conduct, Ford has had issues throughout the years.

To know more about the management innovation helped Henry ford to realize this vision, here

https://brainly.com/question/6978371

#SPJ4

difference between moa and aoa?​

Answers

Answer:

AOA is a set of rule and regulations to govern the company's working. 2. MOA defines objectives, powers and constraints of the organization as a whole. AOA describe powers, duties, rights and liabilities of individuals associated with the organization (like members of the Board of Directors).

Explanation:

i hope i helped <3

write a real life experience that illustrates the process of recruiting, selecting, and training employees.​

Answers

I am not sure I’m sorry

Answer:

Being an astronaut

Explanation:

Which type of rope is used as a belay line when there is a possibility that a victim or firefighter may fall a long distance while supported by the rope?

Answers

Dynamic Kernmantle rope is a type of rope is used as a belay line when there is a possibility that a victim or firefighter may fall a long distance while supported by the rope.

A firefighter is a person whose job is to stop fires from burning or we can say who fights destructive fires. The definition of a firefighter is a person who works at a fire department, either as a volunteer or by profession, who fights fires and rescues people .

firefighter also helps with hazardous materials, road traffic incidents, medical emergencies, floods, and even rescues cats in trees. Firefighters will respond to many different calls for service. Those calls may include structural fires, technical rescues, medical emergencies, and hazardous material spills.

learn more about firefighter here https://brainly.com/question/25483991

#SPJ4

Exploring the cost of transporting goods is part of which step in the screening process for potential markets and sites?

Answers

B) Step 2: Assess the national business environment is part of which step in the screening process for potential markets and sites.

The national environment of a business consists of economic, demographic, natural, cultural and political forces. The external environment of a company is often divided into an economic environment, a political and governmental environment, a sociocultural environment, and an international environment.

A state-owned enterprise is a company that operates within the borders of a particular country. Like local companies, state-owned companies understand the culture of the country and develop products and services to satisfy the market. For example, Donut Time is a donut shop that operates throughout Australia.

The question is incomplete. Please read below to find the missing content.

Exploring the cost of transporting goods is part of which step in the screening process for potential markets and sites?

A) Step 1: Identify basic appeal

B) Step 2: Assess the national business environment

C) Step 3: Measure market or site potential

D) Step 4: Select the market or site

Learn more about the national business environment here: https://brainly.com/question/22728969

#SPJ4

In the graph above, the point E represents values which are __________ with current resource use and current technology.

Answers

In the graph above, the point E represents values which are unattainable with current resource use and current technology.

What point is the unattainable point in the PPC?

PPC refers to production possibility curve, This is a curve that shows the relationship between available resources to what can be attained.

The points outside the curve implies that the producer cannot achieve what they want given the available resources in the economy, however if the points are within the curve the available resources can meet with the intended production

Point E is a is a point that is beyond the graph, that is outside the graph. The resources available cannot attain production.

Read more on the PPC here; https://brainly.com/question/21639807

#SPJ1

Complete question

This is an attachment

Taxes placed on imports to protect domestic producers from foreign competition and to produce revenue for the government are Blank______.Multiple choice question.embargoesincometariffsquotas

Answers

Taxes placed on imports to protect domestic producers from foreign competition and to produce revenue for the government are tariffs.

Tariffs are taxes imposed by using one us on goods or services imported from another United States of America. Price lists are alternate limitations that increase expenses and reduce available quantities of products and offerings for U.S. organizations and customers.

Common types of tariffs are given below.

Specific tariffs.Ad valorem tariffs.Licenses.Import quotas.Voluntary export restraints.Local content requirements.

A tariff is a tax imposed by using a government on items and services imported from other countries that serve to grow the fee and make imports much less perfect, or as a minimum much less competitive, as opposed to domestic items and offerings.

Learn more about tariffs here https://brainly.com/question/26923792

#SPJ4

Assuming that the monopolistic competitor faces the demand and costs depicted below and finds the profit maximizing level of output, what will be the firm’s profit?

Answers

The firms profit that the monopolistic competitor will have Profit maximizing output is found where marginal revenue and marginal cost  curves intersect.

Monopolistic opposition exists while many companies provide competing services or products which might be similar, however no longer ideal, substitutes. The obstacles to entry in a monopolistic competitive industry are low, and the choices of any individual company do no longer directly affect its competition.

To find the proft/loss, find the area of rectangle enclosed by the quantity, price, cost and origin. But since cost per unit is higher than price per unit, the seller will actually incur a loss equal to a negative sign with it.

Learn more about monopolistic competitor here:-https://brainly.com/question/25717627

#SPJ4

Firms operating in the same market, offering similar products, and targeting similar customers are: a. allies. b. competitors. c. multimarket competitors. d. market commonality.

Answers

Firms operating in the same market, offering similar products, and targeting similar customers are competitors.

What are the positives of competition?

Businesses will be more motivated to reduce costs, enhance the quality of their goods and services, and give customers more options when a market is competitive. In other words, companies will need to innovate to differentiate their products from the competition.

why is competition bad for the economy?

Competition reduces your market share and clientele, especially if there is initially little demand for your goods or services. Your return on each product you make and sell may be reduced if a competitive market forces you to cut your prices to remain competitive.

Learn more about competition in economy: https://brainly.com/question/17736624

#SPJ4

_______ is a hybrid ADR in which both parties first submit to mediation for a set period of time (perhaps two business days). If the mediation fails, the process then moves to binding arbitration.

Answers

Discovery, Exculpatory

is a hybrid ADR in which both parties first submit to mediation for a set period of time (perhaps two business days). If the mediation fails, the process then moves to binding arbitration.

What is Hybrid ADR ?

A hybrid dispute resolution process combines two or more traditional dispute resolution processes into one.

The most common hybrid process is med-arb in which the same individual or dispute resolution forum acts first as a mediator and then if necessary, as an arbitrator.

Learn more about Hybrid ADR here:

https://brainly.com/question/23415263

#SPJ4

Evanston Co. owned 60% of Montgomery Corp. Montgomery owned 75% of Noir Inc., and Noir owned 15% of Montgomery. This pattern of ownership would be called...

Answers

Evanston Co. owned 60% of Montgomery Corp. Montgomery owned 75% of Noir Inc., and Noir owned 15% of Montgomery. This pattern of ownership would be called Mutual Ownership. This type of ownership is also know as Reciprocal Ownership.

A reservation can be made by an owner in a rentable unit other than his own is Mutual owners or Reciprocal Owners capability. In this scenario, the owner of the unit he is living in receives any income generated from his own apartment during the time he is occupying another owner's property.

Not all businesses should use mutual ownership arrangements. Mutual models can, however, undoubtedly serve as the foundation for successful, high-performing companies and provide real competitive advantage. For instance, evidence suggests that collective ownership may help to guarantee that choices are made with the long-term viability of the company in mind. Mutual ownership structures and social enterprises provide a mechanism for communities to more evenly distribute the money that businesses generate in the neighborhood, as well as a way for communities to collaborate to address problems.

Learn more about ownership here https://brainly.com/question/25734244

#SPJ1

If LLC members have engaged in fraud or other bad conduct, a court may rely on ______ as the rationale to require members to compensate damaged parties.

Answers

the answer would be LLC membership engaging in bad fraud charges

Tend to add value that is greater than the cost to incorporate them into the supply chain.

Answers

Utility is the 4 P's of the marketing mix's representation of the distribution function. They frequently provide value above the price of integrating them into the supply chain. Wholesalers are privately held businesses that own the products they handle. When consumers determine the worth of a product, they consider the advantages before deducting the disadvantages to determine whether the advantages outweigh the disadvantages.

Everything that shoppers consider before making a purchasing decision is referred to as a value package. Value of a product or service and the quality of the service experience. Social value, personal value, and psychological value are some additional benefits that customers may receive.

To learn more about value, click here.

https://brainly.com/question/15191762

#SPJ1

According to the quantity theory of money, if money supply is $1,000 million, the overall price level is 200, and real GDP is 50 million, then the velocity of money is equal to:

Answers

In the quantity theory of money, MV = PY

V = 200 × 50 / 1000 = 10

Ans a.

P = price level

Y = GDP

V = velocity

M = money supply

Real GDP is a measure of a country's gross domestic product that has been adjusted for inflation.

The transaction's velocity is the number of times on average that a dollar is used for a transaction. If the velocity were fifty-two, for example, then on average a dollar changes hands once each week. Consider a company town, in which weekly town product is $100. The money supply is $100.

Learn more about the velocity of money at

https://brainly.com/question/7206940

#SPJ4

Bond P is a premium bond with a 10 percent coupon. Bond D is a 5 percent coupon bond currently selling at a discount. Both bonds make annual payments, have a YTM of 7 percent, and have five years to maturity. What is the current yield for Bond P and Bond D

Answers

Let Bond par value be 1000

Bond P:

Coupon rate=10%

YTM=7%

time=9 years

Calculation of current price:

Particulars Year Amount PV Factor  YTM=7% Present value

Ineterest 1-9 years 100 6.515232 651.52

Value 9 1000 0.543934 543.93

       1195.45

Current price =1195.45

Current yield=Annual interest based on coupon rate*100/current price

The current yield of Bond P=100*100/1195.45=8.37%

Bond D:

Coupon rate=5%

YTM=7%

time=9 years

Calculation of current price:

Particulars Year Amount PV Factor  YTM=7% Present value

Interest 1-9 years 50 6.515232 325.76

Value 9 1000 0.543934 543.93

       869.69

Current price =869.69

Current yield=Annual interest based on coupon rate*100/current price

The current yield of Bond D=50*100/869.69=5.75%

Capital gains yield

current price bond P=1195.45

Next year's price bond P=100°5.971299+1000*0.582009=1179.14

The capital gain yield on bond P=(next year price-current price)/current price

                                       =(1179.14-1195.45)/1195.45

                                       =-1.36%

current price bond D=869.69

Next year's price bond D=505.971299+1000*0.582009=880.57

The capital gain yield on bond D=(next year price-current price)/current price

                                       =(880.57-869.69)/869.69

                                       =1.25%.

Learn more about premium bonds at

https://brainly.com/question/24126427

#SPJ4

When the required return is constant and equal to the coupon rate, the price of a bond as it approaches its maturity date will?

Answers

When the required return is constant and equal to the coupon rate, the price of a bond as it approaches its maturity date will remain at par.

The interest rate that bond issuers pay on the bond's face value is known as the coupon rate. It is the reoccurring interest rate that bond issuers pay to their buyers. Not the issue price or market value, but the bond's face value (or par value), is used to determine the coupon rate.

A coupon is the interest payment a bondholder receives from the bond's issuing date until its maturity date. Ordinarily, the "coupon rate," which is determined by summing the total annual coupon payments and dividing the result by the bond's face value, is used to characterize coupons.

Learn more about coupon rate here

https://brainly.com/question/7219541

#SPJ4

In international banking, a of is a promise by a bank to pay the seller a given amount if certain conditions are met.

Answers

In international banking, a letter of credit is a promise by a bank to pay the seller a given amount if certain conditions are met.

How Does a Letter of Credit Work?

A letter of credit is frequently used in international trade to guarantee that a payment will be made to the seller promptly and in full, as guaranteed by a bank or other financial institution. In addition to requesting security from the buyer, the bank will charge a fee after providing a letter of credit, which is ordinarily a percentage of the letter of credit. Revolving, commercial, and confirmed letters of credit are a few examples of the different kinds of letters of credit.

What is the disadvantage of a letter of credit?

Inordinately costly, time-consuming, and laborious in terms of working capital and credit line usage. To satisfy the bank's coverage requirements for the buyer, additional security and collateral are required. Lengthy and time-consuming claims process that requires the seller to submit extra documents.

Learn more about a Letter of credit: https://brainly.com/question/3521417

#SPJ4

Which type of collaboration software could best help an organization increase engagement between remote employees and those who are ""in-house"" or organization-based?

Answers

The class of collaboration software that help an organization to increase its engagement between remote employees and in-house employees includes:

cloud-based forumsmessagingmeeting apps

What is a collaboration software?

A collaborative software is also called a groupware.

This class of software are computer program that shares data between computers for processing such as a several programs which have been written to harness the vast number of computers connected to the Internet.

Hence, the cloud-based forums, messaging and meeting app are the class of collaboration software that help an organization to increase its engagement between remote employees and in-house employees

Read more about collaboration software

brainly.com/question/15176746

#SPJ1

An object of weight W is in free-fall close to the surface of Earth. What is the force that the object exerts on Earth

Answers

A very general definition of weight states that : The weight of body is the total gravitational force exerted on the body by every object in the universe.

Near the surface of earth the pull of every other object is negligible in comparison with earth attraction , therefore weight of object is

                    W = mg

What is the force of an object in free fall?

Object that are said to be undergoing free fall are not encountering a significant force of air resistances , that are falling under influence of gravity.

When an object is in free falling it is acted upon by the force of gravity , but the object is not applying its force to the surface the weight of object is zero.

Learn more about force exerted by object on earth

brainly.com/question/23580230

#SPJ4

Bill pays his property tax bill of $980 for the calendar year. He signs a purchase and sale contract on June 28th and closes the sale on July 15th. The contract states, that the seller is responsible for expenses on the day of closing. What is the amount of prepaid taxes due back to Bill at closing. Assume 360 days per year.

Answers

The answer is $530.83.

Given,

For the entire calendar year, Bill pays his $980 property tax bill.

On June 28, Bill formally executes a purchase and sell agreement.

The sale is completed by Bill on July 15.

According to the contract, the seller is in charge of the closing day costs.

A 360-day year is assumed.

Number days till the date of closing = Till June 30 + till July 15

                                                            = (360/2) + 15

                                                            = 180+15

                                                            = 195 days

Therefore, tax paid by Bill till this date will be Prepaid tax.

Amount of prepaid tax = (Total amount of tax/number of days in the year) * Number days till the date of closing

Substituting the values in the above formula,

Amount of prepaid tax = ($980/360) * 195

                                      = $530.833

Hence, the amount of prepaid taxes due back to Bill at closing is $530.83.

Learn more about Tax:

https://brainly.com/question/9437038

#SPJ1

Other Questions
Which statement describes a difference between cliques and crowds?A) Cliques involve more members than crowds.B) Older adolescents are more likely to belong to cliques than to crowds.C) Cliques are assigned by consensus of the peer group.D) Members of a crowd may spend little time with other members. Amit is a college student who is having trouble budgeting any money for savings. What is something he can do to stretch his budget a little to start saving money for his future?a. He can buy a house, setting aside the money he would have spent on rent.b. He can buy his coffee at Starbucks, setting aside the money he would have spent on a coffee machine and bags of coffee.c. He can take a student loan, setting aside the money he would have spent on tuition and books.d. He can prepare and eat more meals at home, setting aside the money he would have spent as restaurants. within the decentralization concept of delegating authority and responsibility, which is not a responsibility center? group of answer choices investment center profit center revenue center cost center Buchanan Corp. is refunding $12 million worth of 11% debt. The new bonds will be issued for 7%. The corporation's tax rate is 33%. The call premium is 8%. What is the net cost of the call premium?Which is the correct answera. $647,700b. $643,200c. $658,200d. $678,200 The 5 things I have learned in Ms PowerPoint FILL THE BLANK. according to your reading, since the mid-1990s the policy used on the us-mexico border has been known as _____________________, driving hopeful migrants into the hostile terrain of the desert. The Secretary of State often responds first to international crises by coordinating, aiding, negotiating, and attempting to influence the outcome of events.A. True B. False Write the equation for the following story: jadas teacher fills a travel bag with 5 copies of a textbook. the weight of the bag and books is 17 pounds. the empty travel bag weighs 3 pounds From the point of view of economic efficiency, output in a monopolized market is a. too high. b. perfect. c. too low. d. undesirable. FILL IN THE BLANK.The ______ is the connection from a home or business to the telephone company end office. the target date funds used as examples in class tended to invest in index mutual funds like the total u.s. stock market and the total world stock market and a bond index fund. True or False Segn el artculo, qu representa el merengue para la Repblica Dominicana?Es un ritmo que tiene sus orgenes en la actualidad Malik finds some nickels and quarters in his change purse. How many coins does he have if he has 5 nickels and 4 quarters? How many coins does he have if he has x nickels and y quarters? consider a binary liquid mixture for which the excess gibbs free energy is given by ge/rt= ax1x2(x1 2x2). what is the minimum value of a for which liquid-liquid equilibrium (lle) use the common tangent construction to determine the activity of pb in systems with the following compositions at 200 c. please give a numerical value for activity. write the equations in cylindrical coordinates. (a) 9x2 2x 9y2 z2 = 1 (b) z = 2x2 2y2 The sequence of part of an mRNA transcript is 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3' What is the sequence of the DNA coding strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG consider the lifting without the pulley at aa . draw the free-body diagram of the man. the man has a center of gravity at g Discussion 4 (Perfect Competition and Monopoly) a 1. Compare the four market characteristics for perfect competition and monopoly 2. If two markets have the exact same market demand: P = 200 - Q, but market 1 is structured as perfect competition while market 2 is monopoly. If both markets have marginal cost as MC = 4, what will be the market price and market output for these two different markets (for monopolistic market MR = 200 - 2Q)? Show your work and supporting calculation. 3. We seldom see the commercials from producers in a perfectly competitive market. What could the reasons behind this observation. 4. A perfectly competitive firm operates in a market with current price of $11 per unit. The firm's total cost function is TC = 1000 + Q + 0.005Q2, MC = 1 + 0.010 how much the firm should produce to maximize its profit? calculate the maximized profit. Draw a graph to show your result. what are ecell and g at 25c for a redox reaction for which n=2, and k=0.075