In the lesson, maarit and her maya ancestors grew ________ as part of their routine.

Answers

Answer 1

Maarit and her Maya ancestor's civilizations grew potatoes, corn, beans, squash and chilies as part of their routine.

Which plants evolved from America?

Different types of plants evolved in America and were selected by native civilizations, which include, among others,  potatoes, corn, beans, squash and chilies.

Conventional breeding techniques were used by native civilizations such as Maya civilization in order to produce new crops, including maize, which is an extensive crop plant that shows genetic heterosis (it is an allogamous plant).

In conclusion, Maarit and her Maya ancestor's civilizations grew potatoes, corn, beans, squash and chilies as part of their routine.

Learn more about American native plants here:

https://brainly.com/question/3457447

#SPJ1


Related Questions

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

HELP ASAP WILL GIVE BRAINLISET Which of the following describes the Cell Theory?

Group of answer choices

(A)All

(B)All living things are composed of one or more cells.

©Cells are the basic unit of life

(D)Cells are produced from existing cells

Answers

Answer:

C. Cells are the basic units of life.

Explanation:

Answer: A.) All
Explanation: Wikipedia :/

What change caused the rate of population growth to increase around point C?

Answers

Answer:

point c

Explanation:

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

What sentence best supports the statement that hormones are involved in the regulation of homeostasis?

A.
The hormone cortisol suppresses the immune system and is produced when the body is under stress.
B.
The hormone oxytocin promotes labor contractions of the uterus during childbirth.
C.
The hormone melatonin induces sleep and its production is slowed by exposure to light.
D.
The hormone erythropoeitin increases the production of red blood cells when oxygen levels are low.

Answers

Answer:

D

Explanation:

It is an homeostatic process

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

Material rising from the mantle reaches the surface at spreading centers.
A. True
B. False

Answers

Yes, It's true!

Explanation:

Material rising from the mantle reaches the surface at spreading centers.

A. True

B. False

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

match the choices with each box.

Answers

Answer:

1 is totipotent

2 is mutipotent

3 is pluripotent

4 is totipotent

5 is pluripotent

6 is mutipotent

Explanation:

I honestly dont know sorry if they r wrong

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

A student knows the width and
length of a dresser. What else
should she measure so she can
calculate the volume?
A. Mass
B. Density
C. Height

Answers

Answer:

C. Height

Explanation:

The volume of a rectangle is Length x width x height.

The student has only measured the width and length so far, the only thing left to measure is the height.

The other answers don't make sense.

Hope this helps!!

- Kay :)

Answer:

c

Explanation:

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

Mitosis is done by your body cells. What types of cells do not undergo mitosis

Answers

Answer:

Sex cells/ gametes

Explanation:

Sperm cells and egg cells don't go through mitosis

If you wanted to find an ant's stomach, where would
you look?
a. Inside its head
b. Inside its cephalothorax
c. Inside its thorax
d. Inside its abdomen

Answers

Answer:

d. Inside its abdomen

Explanation:

Hope this helps!

D, inside its abdomen

Yall Im struggling, if u cant read it, the question is “why does a mountain climber need an oxygen supply at very high altitudes, even tho the air still contains 21% oxygen?

Answers

Answer: Because it is harder to draw breath in. And the cold

Explanation: At higher altitudes, it becomes more dangerous, and you can develop altitude-related illnesses such as HAPE and HACE. I read a book called Into Thin Air, and in the book the author goes into detail on the details/complications of climbing Mt.Everest and oxygen needs. Mountain climbers use canisters of oxygen called Supplemental Oxygen.

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

Without genetic variation, natural selection would not be possible. Explain why.

Answers

Answer:

Without genetic variation, natural selection is only able to grow the number of allelomorphs that previously exited in the population. Natural selection occurs through an interaction between the environment and the variability of the individual organisms making up a population. If every giraffe had the same neck length, there would be nothing to change and they would never have a long neck by now.

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Phineas and Ferb build a flying machine. They accelerate into the air in a
straight line, going from 0 m/s to 30 m/s in 3 s. Find their average
acceleration.

Answers

10

30 dived by 3 = 10

hope it helps

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

What thing controls the functions of the different cells ? (Hint it is inside the nucleus)

Answers

Answer:

DNA

Explanation:

It's the genetic material that writes up who we are.

But if it's discussing an organelle, then it's the nucleus.

Have a great day!

Which of these contributes the most oxygen to our planet?

a. Photosynthetic fungi
b. The Amazon Rain forest
c. the National Forests
d. Phytoplankton

Answers

Answer:

D. Phytoplankton

Explanation:

The majority of this production is from oceanic plankton — drifting plants, algae, and some bacteria that can photosynthesize.

Have a wonderful day! <3

Answer:

D

Explanation:

this is because the ocean produces the most oxygen and most of that comes from plankton in the ocean

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

Other Questions
Mr. Mika paid a total of $150 to rent a room at a hotel for two nights. The table shows information about four otherguests who rented rooms at the hotel.Hotel BillsNumber of NightsRoom Was RentedTotal AmountPaidGuest16$450II3$225III8$600IV5$360Which guest did NOT pay the same nightly rate that Mr. Mika did? what is the ratio then what is the value of the ration? Question 3(Multiple Choice Worth 1 points)(06.01 LC) Read and choose the option with the correct word or words to complete the sentence.Yo soy extrovertido. Despus de estudiar, me gusta ________ cuando mis amigos cantan. tocar un instrumento estar solo hacer la tarea practicar yoga Which expression represents the factor form of the equation above ? Which example violates the 6th Amendment's guarantee of a fair trial?Answers- A.) An accused is refused bail because the judge fears he will try to flee.B.) A trial is moved to a different county to avoid a biased jury.C.) An attorney advised his client not to testify at her own trial.D.) A suspect is secretly put on trial by the police at an undisclosed location. The uplift of the Colorado Plateau was caused by energy from Choose . This energy also caused Choose in the rock layers that make up Bryce Canyon, Zion Canyon, and the Grand Canyon, as well as Choose below Earth's surface. The processes that formed Bryce Canyon take place over a Choose . 50 points!! answer asap! Write two paragraphs each for how Telegraph communications and the typewriter were one of the greatest inventions during the industrial revolution Learning how to play viola! How do you know where to write where you hover and drop in music? need to know the middle part When converting 6/81 into a decimal which is true. Iron has density 7.87 g/cm", which means that acube with side length 2.54 cm will have mass: Determine if the triangles are congruent by HL, SAS, SSS, AAS, orASASomebody help please!!! If five times the square of a certain positive number isdecreased by twice the number, the result is 16. Find thenumber [Only an algebraic solution will be accepted.] To TWO significant figures, the measurement of 0.0255 g should be reported as Water that falls from the clouds onto land could become ______ and travel to the ocean A. EvaporationB. CloudsC. CondensationD. Runoff HELP QUICKLY?? 100 POINTS!!! 10. What images does Thomas create with his words in this stanza (what do you see in your head based on his descriptions)? Make sure to provide textual evidence to support the imagery you see. describe one way in which the body gets rid of lactic acid A bag has some purple marbles andsome green marbles in it. This can bemodeled with the following equation.T = p + g.Solve the equation for the number ofpurple marbles, p.Enter the variable that belongs in the green box.p = [?] - [ ] Help please and tysm6 x (5 + 4) - 3 - (2+1)A 18B) 30C) 48D) 54 which lists the multiple of 8 A. 8,16,24, 46 B.8,16,24,48 C.8,15,32,50 D.8,16,40,63