Of the three states of matter -- solid, liquid, and gas -- which one exerts the highest pressure on its container, and why?

Answers

Answer 1

Answer:

gas because its going super fast and free

Explanation:


Related Questions

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

Which of the following most accurately describes the National Postsecondary Agricultural Student Organization?
(a)A rival group to FFA.
(b)2.A group similar to FFA but for graduate students.
(c)A group similar to FFA but for college students.
(d)The British version of FFA.

Answers

Answer:

Explanation:

a

Answer:

It's a

Explanation:

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

The effect of disorder of checkpoints proteins and cell cycle regulation
I need help!!!!!!???

Answers

Answer:

LEARNING OBJECTIVES

Identify important checkpoints in cell division

Explain how errors in cell division are related to cancer

The length of the cell cycle is highly variable, even within the cells of a single organism. In humans, the frequency of cell turnover ranges from a few hours in early embryonic development, to an average of two to five days for epithelial cells, and to an entire human lifetime spent in G0 by specialized cells, such as cortical neurons or cardiac muscle cells. There is also variation in the time that a cell spends in each phase of the cell cycle. When fast-dividing mammalian cells are grown in culture (outside the body under optimal growing conditions), the length of the cycle is about 24 hours. In rapidly dividing human cells with a 24-hour cell cycle, the G1 phase lasts approximately nine hours, the S phase lasts 10 hours, the G2 phase lasts about four and one-half hours, and the M phase lasts approximately one-half hour. In early embryos of fruit flies, the cell cycle is completed in about eight minutes. The timing of events in the cell cycle is controlled by mechanisms that are both internal and external to the cell.

Explanation:

Regulation of the Cell Cycle by External Events

Both the initiation and inhibition of cell division are triggered by events external to the cell when it is about to begin the replication process. An event may be as simple as the death of a nearby cell or as sweeping as the release of growth-promoting hormones, such as human growth hormone (HGH). A lack of HGH can inhibit cell division, resulting in dwarfism, whereas too much HGH can result in gigantism. Crowding of cells can also inhibit cell division. Another factor that can initiate cell division is the size of the cell; as a cell grows, it becomes inefficient due to its decreasing surface-to-volume ratio. The solution to this problem is to divide.

Whatever the source of the message, the cell receives the signal, and a series of events within the cell allows it to proceed into interphase. Moving forward from this initiation point, every parameter required during each cell cycle phase must be met or the cycle cannot progress.

Regulation at Internal Checkpoints

It is essential that the daughter cells produced be exact duplicates of the parent cell. Mistakes in the duplication or distribution of the chromosomes lead to mutations that may be passed forward to every new cell produced from an abnormal cell. To prevent a compromised cell from continuing to divide, there are internal control mechanisms that operate at three main cell cycle checkpoints. A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. These checkpoints occur near the end of G1, at the G2/M transition, and during metaphase

plz mark me as brainleast my friend

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

With respect to normal base pairing, when a molecule of DNA replicates, thymine will most likely pair with 2 points

Answers

Answer: Adenine

Explanation:

The structure of the DNA double helix is complex in nature. There are two strands of DNA that are wound around each other. The nitrogenous bases are bonded with hydrogen bonding and base complementarity. According to the Chargaff's rule of base complementarity adenine always pairs with the thymine and guanine with cytosine. These nitrogenous bases are paired on the basis of hydrogen bonding. Adenine bonded with thymine through two hydrogen bonds whereas the cytosine pairs with guanine via three hydrogen bonds. During DNA denaturation these hydrogen bonds are broken whereas during DNA replication these hydrogen bonds are formed between the nitrogenous bases.

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

What is the strengths and weaknesses of the various developments in science and technology​

Answers

Answer:

Strengths, Weaknesses, Opportunities and Challenges ... Some have “ centres for research and development” while others ...

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

what are some products that come from plants?

Answers

Answer:

Aspirin tablets. Sponges. ...

Sponges made from trees. Chewing Gum. ...

Sapodilla tree. Carnauba Wax. ...

Copernicia prunifera. Henna Dye. ...

Henna tattoo. Rubber. ...

Tapping into trees for rubber.

Answer:

Rubber, sponges

Explanation:

these are Frome trees

Which feature is forming?

Oceanic crust
Continental
crust
Lithosphere
Lithosphere
Asthenosphere

Answers

Answer:

An island

Explanation:

for me i got it right

What type of material did the water most likely encounter when it stopped?

Answers

Answer:

Rocks

Explanation:

Rocks normally stop streams

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

Select the item(s) that describe a producer.

1.takes energy from the sun
2.helps rot dead organisms
3.fungus
4.tall grass
5.food is mostly animal
6.plant eater
multiple choice

Answers

Answer:

3. fungus

4. tall grass

5. food is mostly animal

But this on your own sentences please

Answers

Since hydropower is powered by water, it’s a good fuel source. It will not contaminate the air like power plants that release fossil fuels, for example coal and oil. It does not rely on international fuel sources and lets each state make their own energy.

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

What are 2 facts about energy?

Answers

Answer: Only 10 percent of energy in a light bulb is used to create light. ...

The amount of energy Americans use doubles every 20 years. ...

Explanation:

Fact 1: Refrigerators in the U.S. consume about the same energy as 25 large power plants produce each year.

Fact 2: From 2008 to 2030, world energy consumption is expected to increase more than 55%.
Other Questions
scientist released 8 rabbits into a new habitat in year 0. Each year, there were twice as many rabbits as the year before. How many rabbits were there after X years? Write a function to represent this scenario. In the town of Rockville, 3/5 of the students in middle school participate in organized sports after school. If 1/4 of them play basketball, what fraction of the students play basketball? Seventy percent of kids who visit a doctor have a fever and 21% of kids have fever and sore throats . What is the probability that a kid who goes to the doctor has a sore throat given that he has a fever? -Why has globalization increased?1. 2. Using semantic features, how would you explain the oddness of these sentences? i ate a bowl of happiness for lunch with a plate of juice on the side. Joel spends 272727 more minutes playing soccer after school on Tuesday than he did on Monday. He still exercises for a total of 606060 minutes after school.What percent of his time exercising after school did Joel spend playing soccer on Tuesday? Mark this and retumSRWhich statements are true about triangle QRS? Selectthree options.The side opposite ZQ is RS.The side opposite ZR is RQ.The hypotenuse is QR.The side adjacent to ZR is SQ.The side adjacent to 4Q is QS.Save and ExitNextSubmit Please help asap!! Eliza loves Christmas, and has seen the play and movie of Dickens "A Christmas Carol" many times. Now, herteacher has asked her to prepare a report about the book. How might her perspective affect her reaction to thebook? Today's smartphones are smart but tomorrow's gadgets will inevitably be even smarter. According to experts, soon they will have 'emotional intelligence'. They will be able to (1)______how we feel and react to our mood, by joining in our happiness or leaving us alone a technology that uses both speech-recognition when we are angry. Scientists are Behavioral economists suggest that consumers will be indifferent between a price of 99 and a price of $1. a) true b) false Symptoms of ________ deficiency include glossitis, dermatitis, cheilosis, eye disorders, sun sensitivity, and confusion. 2x-3/x divided 7/x^2 An object moving with 108 km/h moves 400 m in 8 seconds. find the velocity attained by the object. after two half-;ives (9 billion years) what percent of the orignal uranium remains? An ideal gas is at a temperature of 300 K. To double the average speed of its molecules, what does the temperature need to be changed to What is the primary argument of the interactional perspective of organizational behavior? Some analytes must be derivatized to increase their column retention or detectability. Derivatization means Group of answer choices altering the chemical structure of the analyte to increase detection and specificity. adding fluorescent labels or combining the analyte with chiral reagents or other chemicals to increase detectability. removing dissolved gases in the solvent to produce a clear chromatogram. using multiple detectors to assist in identification. What are hollow corporations? A. companies that market their products through franchisees B. companies that outsource all production to suppliers C. companies that have liabilities exceeding their assets D. companies that are horizontally integrated E. companies that do not have any physical presence and only operate online One of the most important responsibilities for professionals in the HR field is The graph of a line passes through the two points below (2,-4);(-3,1)Which of these can be used to determine the slope of the line