Phenylketonuria (PKU) is a genetic disease caused by the inability to break down the amino acid phenylalanine. If untreated it leads to severe mental disabilities. PKU is due to a recessive allele. Assume that the US population is in Hardy-Weinberg equilibrium with respect to this gene. In the US the PKU rate is 1 out of every 10,000 babies born. What percent of the US population have no alleles for PKU

Answers

Answer 1

Answer:

Therefore, 98% of the US population have no alleles for PKU

Explanation:

The Hardy-Weinberg equilibrium states that the amount of genetic variation in a population will remain constant from one generation to the next in the absence of disturbing factors.

The Hardy-Weinberg equilibrium is expressed quantitatively using a mathematical equation known as the Hardy-Weinberg equation. the equation is given below:

p² + 2pq + q² = 1

also, p + q = 1

Given a pair of alleles, S and s with A dominant and a recessive

where p is the frequency of the dominant allele in the population,

q is the frequency of the recessive allele in the population,

p² represents the frequency of the (SS)  dominant genotype,

q² represents the frequency of the (ss) recessive genotype,

2pq represents the frequency of the heterozygous genotype

From the given question,

q² = 1/10000 = 0.0001

q = 0.01

from p + q = 1

p = 1 - 0.01 = 0.99

p² = 0.98

Therefore, 98% of the US population have no alleles for PKU


Related Questions

PLEASE HELP!!!!
Explain what causes a muscle to go into rigor mortis. Your answer should include the circumstances which cause it, as well as why those circumstances cause the effect (what is happening in the muscle at a molecular level which causes the stiffness). ​

Answers

Explanation:

Rigor mortis develops as the body's energy source (adenosine triphosphate [ATP]) is depleted. Muscle fibers require ATP for relaxation; once depleted, actin and myosin proteins remain complexed, resulting in stiffening of the muscles..

Thanks my answer and vote it 5 star and Mark it in brainliest answers please please please please please please please please please please please please please please please please please please please please please please

The mutations responsible for the dark fur color in the Arizona mice were absent from the three different populations of New Mexico mice. No Mc1r mutationswere associated with dark fur color in the New Mexico populations. These findings suggest that adaptive dark coloration has occurred at least twice in the rock pocket mouse and that these similar phenotypic changeshave different genetic bases. How does this study support the concept that natural selection is not random

Answers

Answer:

Following are the solution to the given question:

Explanation:

Please find the complete question in the attached file:

In the given question, the whole study reinforces the fact which natural selection also isn't transformed through producing much more confirmation which genetic polymorphisms occur because once required as well as that they can produce the very same mutation as a function of climate transformation except in specific environments.

Which hot and dry biome is home to large herds of herbivores that feed on many types of grasses?

Answers

Answer:

grasslands

Explanation:

You perform an experiment in which chromatin is isolated from sea urchin sperm cells and briefly digested with micrococcal nuclease. When the chromatin proteins are removed and the resulting purified DNA is analyzed by gel electrophoresis, you observe a series of DNA fragments that are multiples of 260 base pairs in length (that is, 260 bp, 520 bp, 780 bp, and so forth). a) Although these results differ somewhat from the typical results discussed in the chapter, explain why they still point to the likely existence of nucleosomes in this cell type. b) What can you conclude about the amount of DNA that is associated with each nucleosome

Answers

Answer:

a) DNA fragments associated with histone proteins are all multiple in length (i.e., 260 bp, 520 bp, 780 bp, etc), thereby suggesting the presence of a pattern of organization in the chromatin  

b) it suggests that each unit of organization (ie, each nucleosome) consists of 260 bp associated with chromatin proteins

Explanation:

The nucleosome is considered as the basic unit of chromatin. A nucleosome consists of approximately two turns of DNA wrapped around a core of eight histone proteins (i.e., a histone octamer). The histone octamer consists of two copies of each of the histones H2A, H2B, H3, and H4. Moreover, the nucleosomes are connected together by linker DNA sequences which vary between 10 and 100 bp in length.

In ancient times, people believed Earth was the center of the Solar System. Which of the following makes the geocentric model impossible?
O The moon revolves around Earth.
O Earth's gravitational force is much less than the Sun's.
o Orbits are elliptical, not circular
There are other planets that are closer to the Sun.

Answers

I believe that the answers is “Earth’s gravitational force is much less than the Sun’s”

I hope I was helpful! Have a nice day! ~(^v^)~

Given a DNA sequence of ACG, what would be the corresponding RNA sequence? Once you determine the RNA sequence, what would be the corresponding amino acid for the RNA codon? Would a change in one nucleotide of the DNA alter the corresponding amino acid? Explain.

Answers

Answer:

- RNA sequence: UGC

- Amino acid sequence: Cysteine

- Yes, a change in nucleotide will alter the amino acid.

Explanation:

According to this question, a DNA sequence was given as follows: ACG. The process of transcription will produce a RNA sequence from this DNA sequence using complementary base pairing i.e. A-U, G-C etc. Based on this, the mRNA sequence that will result of the DNA sequence above is UGC.

The resulting mRNA transcript is a codon (three nucleotides) that will be used in the process of translation to yield an amino acid. The mRNA sequence: UGC codes for amino acid Cysteine.

- A change in one nucleotide of the DNA will alter the corresponding amino acid because DNA sequence in a particular reading frame is responsible for the production of amino acid. Hence, a slight change in nucleotide might change the reading frame of the sequence and hence give rise to a different amino acid.

describe how you would test a sample of powdered milk to see if it contained protein ​

Answers

Answer:

How would you  contained protein ​

Explanation:

One would test a sample of powdered milk to see if it contained protein ​by using copper sulfate solution and  sodium hydroxide solution.

What is protein?

A structure composed of amino acids. The body need proteins to function properly. They serve as the building blocks for several bodily components, including the skin, hair, and enzymes, cytokines, and antibodies.

An essential component of a balanced diet is protein. Amino acids are the chemical "building blocks" that make up proteins.

Amino acids are used by your body to create hormones, enzymes, and to build and repair muscles and bones. They can be utilized as a source of energy as well.

The test can be done as:

To your meal solution, add a few drops of copper sulfate solution. A few drops of sodium hydroxide solution should be added. Protein is present in the food if the solution becomes purple.

Thus, using copper sulfate solution and sodium hydroxide test, one can determine the protein content in the sample.

For more details regarding protein, visit:

https://brainly.com/question/29776206

#SPJ2

Which is an adaptation that helps birds maintain a stable body temperature?
air sacs connected to lungs
large chest muscles
down feathers
nearly hollow bones

Answers

Which is an adaptation that helps birds maintain a stable body temperature?

down feathers

Answer:

the answer is down feathers. Or C

Explanation:

I just took the unit review test

Ethylene, a hormone found in plants, is produced to ripen fruits. These fruits ripen and drop to the ground where they release seeds. Which two plant systems are interacting when this occurs?

Answers

Answer:

Response and reproduction system

Explanation:

Where do nutrients enter the body?

Answers

Answer:

thru the nucleus or cell wall i think

Explanation:

Answer: The small intestine absorbs most of the nutrients in your food.

Explanation: The small intestine is good for absorption due to it having a large inner surface area.

Which of these genotypes represents a carrier?
Аа
aa
XXY
AA

Answers

Answer:

Aa

Explanation:

from what I can remember from 7th grade science

This equipment can be used for plowing ,planting,cultivating,mowing soil and pulling farm machinery,what is it?​

Answers

Is the moldboard plow

Which statement is true about a red brick?
A red brick reflects red light and absorbs blue and green light.
O A red brick reflects blue light and absorbs red and green light.
A red brick reflects green light and absorbs blue and red light.
O A red brick reflects blue and green light and absorbs red light.

Answers

Answer:

1. red brick reflects red light and absorbs blue and green light.

The statement which is true about a red brick is: A. A red brick reflects red light and absorbs blue and green light.

An electromagnetic spectrum refers to a range of frequency and wavelength that an electromagnetic wave is distributed (extends).

Generally, an electromagnetic spectrum comprises the following radiations:

Gamma rays.Ultraviolet radiation. X-rays. Radio waves. Infrared radiation.Visible light.

A visible light can be defined as the range of electromagnetic radiation or wavelength that the human eye can detect or see.

Also, the colors of the visible light spectrum are:

Red.Orange.Blue.Indigo.Green.

For a red brick, all red light would be reflected while the other colors such as blue and green light are absorbed.

Read more: https://brainly.com/question/23419308

Sexual harassment in the workplace is a crime when committed by anyone, regardless of position, role, or gender. Please select the best answer from the choices provided ОТ OF​

Answers

Answer:

The answer is true.

In a professional environment, sexually degrading comments and actions are legally prohibited.

Transcription is the process of making

Answers

Transcription is the process of DNA copying into messenger RNA (mRNA)

Which resource is nonrenewable? A. Wind B. Trees C. Coal D. Soybeans

Answers

The Answer = C: Coal
C. coal, it’s a fossil that can not be produced again.

Based on scale of 100 and represents average performance

Answers

Answer:

Ok what is the question good sir/madam?

Answer:

Explanation:

Yes i agree with the other answer SIr or Ma'am but i don't know if this question!

Which of these is an impact of burning coal for energy?
A. acid rain
B. mercury released into the waterways
C. Increased carbon dioxide in the environment
D. all of the above

Answers

The answer is D. All of the above
The answer is D all of the above

B. Suspension c. Solution
D. Saturated solution
5. Which is a solvent in a cup of coffee?
A. coffee
B. creamer
c. sugar
D. water
6. Why should you shake the liquid medicine before drinking?
A. To make it effective. C. To mix the suspended particles at the bottom.
B. To make it taste better. D. To make it clear.
7. What should be done in a liquid medicine before drinking it?
A. Drink right away after opening. C. Let it stand for 3 minutes
B. Shake well
D. All of these
8. Which of the following is called a universal solvent?
A. water 8. gasoline C. juice D. diesel
m-Directions: For items 1-5 What method are you going​

Answers

Answer:

5.c 6.c 7.b 8.a

Explanation:

I hope it helps u :)


Which feature of the Earth's surface is caused by wind?
A)
rock quarries
B)
canyons
C)
sand dunes
for
D)
mountains

Answers

Answer:

b canyons

Explanation:

in what parts of the cycle do you think phosphorus spends the most time​

Answers

Answer:

what is a phosphorus

Explanation:

HELP ME
MARKING BRANELIST

Answers

Answer:

I think the answers probably b

What is AB?
A
12
B.
C
35

Answers

Answer:

hah? i don't get it

Explanation:

PLEASE HELP ME!!!!!!!​

Answers

Answer:

The last one

Explanation:

Short Pea Plants only, is your answer

These are carbohydrates -rich vegetables EXCEPT
a. Tubers
b. nuts
c. seeds
d.roots​

Answers

The answer is a. Tubers
roots - “they are so high in carbohydrates that they are more like grains than greens” :)

Determine the rate of oxygen consumption at each temperature for comparison. Then divide the higher rate by the lower rate to obtain the difference (ratio) between the two temperatures. Round your answer to the nearest 0.1. It can be concluded that mouse respiratory rate (increases or decreases) when temperature is lowered. In this experiment there was a fold difference in respiratory rate at the two temperatures.

Answers

Answer:

In mice rate of respiration increases as the temperature drops.

Explanation:

As the temperature decreases, the respiration rate also decrease because the body needs less oxygen for the production of energy. But in the case of mice, the rate of respiration decreases and the reason is the fear. Results showed that the respiration increased in mice as the decrease in temperature occur, caused due to the fear instilled in the mice towards cold temperature so in mice rate of respiration increases as the temperature drops.

Apply: Suppose a template strand of DNA had the following sequence: T A C G G A T A A C T A C C G G G T A T T C A A What would be the complementary strand of mRNA?

Answers

AUG CCU AUU GAU GGC CCA UAA GUU

The corresponding nucleotide sequence is present on the coding strand. No complementary sequence exists on the template strand.

What changes occur in complementary strand from template?

The DNA strand from which the mRNA is produced is known as the template strand. The DNA strand opposite the template strand is known as the coding, or non-template, strand, and it has the same sequence as mRNA except T to U substitutions.

The template strand, one of the two exposed DNA strands, acts as a model for transcription.

The RNA product is essentially identical to the non template (or coding) strand of DNA and is complementary to the template strand.

Therefore, AUG CCU AUU GAU GGC CCA UAA GUU is the complementary strand of mRNA.

Learn more about complementary strand here:

https://brainly.com/question/13768651

#SPJ3

What evidence do we have that all continents were merged into one super-continent called Pangaea 250 million years ago?

Answers

Glacial deposits, specifically till, of the same age and structure are found on many separate continents that would have been together in the continent of Pangaea. Fossil evidence for Pangaea includes the presence of similar and identical species on continents that are now great distances apart.

Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.

Answers

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

Because it's most resistant to deterioration, which type of molecule is most often found in molecular fossils?

A. RNA molecules
B. Protein molecules
C. DNA molecules
D. Lipid molecules

Answers

Answer:

Of the four main groups of organic molecules, Lipids are the most resistant to decay. They are also highly insoluble in water. All cells produce this type of organic compound to be used in their membranes and in energy storage. These type of organic molecules are found in kerogens

Other Questions
What is Ruby's Wish theme? ability of a cell to form the whole organism Corrie breathed 1 10^7 times in a year. She blinked 8 10^6 times that year. How many more times did Corrie breathe in a year than she blinked in that year? Write your answer in standard notation You should use a multimedia slide or canvas only if __________. a. the slide or canvas highlights important points b. your presentation is longer than ten minutes c. you have completed training in developing and using the software d. you develop your ideas using the direct organizational strategy Your test scores in one class are 79 and 83. What possible scores can you earn on your next test to have a test average between 81 and 87, inclusive? 8th class 10th lesson Answer. 5s + 2z = 1.32 3s + 1z = 0.75 what would the answer be? There are 60 children in a club.In the club, the ratio of the number of girls to the number of boys is 3:135 of the girls play a musical instrument.45 of the boys play a musical instrument.What fraction of the 60 children play a musical instrument? I NEED HELP PLZ I WILL GIVE BRAINLIST AND POINTSWhat was an important contribution of the Catholic Church during the Middle Ages? Determine the equivalent system for the given system of equations.4x 5y = 210x 21y = 10A. 4x 5y = 23x y = 4B. 4x 5y = 224x 47y = 22C. 4x 5y = 210x + 3y = 15D. 4x 5y = 214x + 26y = 12 At standard pressure, a sample of oxygen occupies 31 ml. What volume does the gas occupy when the pressure is 2 atm? Several items are omitted from the income statement and cost of goods manufactured statement data for two different companies for the month of May:1 Rainier Company Yakima Company2 Materials inventory, May 1 $100,000.00 $48,200.003 Materials inventory, May 31 (a) 50,000.004 Materials purchased 950,000.00 710,000.005 Cost of direct materials used in production 938,500.00 (a)6 Direct labor 2,860,000.00 (b)7 Factory overhead 1,800,000.00 446,000.008 Total manufacturing costs incurred May (b) 2,484,200.009 Total manufacturing costs 5,998,500.00 2,660,600.0010 Work in process inventory, May 1 400,000.00 176,400.0011 Work in process inventory, May 31 382,000.00 (c)12 Cost of goods manufactured (c) 2,491,500.0013 Finished goods inventory, May 1 615,000.00 190,000.0014 Finished goods inventory, May 31 596,500.00 (d)15 Sales 9,220,000.00 4,550,000.0016 Cost of goods sold (d) 2,470,000.0017 Gross profit (e) (e)18 Operating expenses 1,000,000.00 (f)19 Net income (f) 1,500,000.00Required:a. Determine the amounts of the missing items, identifying them by letter. Enter all amounts as positive numbers.b. Prepare Yakima Companys statement of cost of goods manufactured for May. For those boxes in which you must enter subtracted or negative numbers use a minus sign.*c. Prepare Yakima Companys income statement for May. Enter all amounts as positive numbers.** Refer to the Amount Descriptions list provided for the exact wording of the answer choices for text entries.Starting Questiona. Determine the amounts of the missing items, identifying them by letter. Enter all amounts as positive numbers.Letter Rainier Company Yakima Companya. b. c. d. e. f. Statement of Cost of Goods Manufacturedb. Prepare Yakima Companys statement of cost of goods manufactured for May. Refer to the Amount Descriptions list provided for the exact wording of the answer choices for text entries. For those boxes in which you must enter subtracted or negative numbers use a minus sign.Yakima CompanyStatement of Cost of Goods ManufacturedFor the Month Ended May 3112Direct materials:34567891011Total manufacturing costs1213c. Prepare Yakima Companys income statement for May. Refer to the Amount Descriptions list provided for the exact wording of the answer choices for text entries. Enter all amounts as positive numbers.Yakima CompanyIncome StatementFor the Month Ended May 3112Cost of goods sold:345678910 Destiny just received two separate gifts from her great-great-grandmother.The first gift is a box of 181818 chocolate candy bars, and the second gift is a pack of 121212 cookies.Destiny wants to use all of the chocolate candy bars and cookies to make identical snack bags for her cousins.What is the greatest number of snack bags that Destiny can make? Can somebody please help me please An open pipe is 1.42 m longWhat fundamental frequencydoes it produce?(Speed of sound = 343 m/s)(Unit = Hz) 16 multiplied by half a number Which one is a unit rate?sk5 pounds in 2 bags15 miles per gallon$8.00 for 3 boxes of oranges22gallons of water in 5 days why do they call it the facial muscle 4.6 isosceles and Equilateral triangles what is the sum of /-10/ and /6/