Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Bones in the legs, arms, spine and pelvis grow
A)at different rates.
B)at the same rate.
C)until age 18, then they stop.
D)strongest after age 30.
Answer:
C
Explanation:
Bones in the legs, arms, spine and pelvis grow at different rates, so option a is correct answer as during childhood and adolescence, bone growth is actively occurring, and different bones may experience growth spurts at different times.
Long bones, such as those in the legs and arms, typically undergo rapid growth during puberty. These bones have growth plates, also known as epiphyseal plates, located near the ends. The growth plates are responsible for the lengthening of the bones. As individuals reach adulthood, usually around the age of 18-20, the growth plates close and bone lengthening ceases.
Learn more about bones here
https://brainly.com/question/29910405
#SPJ2
PLEASE HHELP ASAP!! I'LL MARK BRAINLIEST FOR FULL ANSWER!!
Recovering Ecosystems Worksheet Section 1: Select the Kitakami River region, the Abukuma Highlands, or Japan's coastal habitat as the ecosystem you want to help with recovery. List the main problem faced by this ecosystem as described in the lesson. Then list at least two sub-problems that need to be considered to solve the main problem. List the sub-problems in order of most to least important. In the rationale column, explain why you placed your sub-problems in the order you selected. Main Problem Sub-Problems Rationale Section 2: Conduct internet research on your selected ecosystem to help you generate a list of three criteria and two constraints. Your criteria and constraints should consider relevant factors to the problem, such as costs, reliability, safety (to humans and wildlife), human needs, environmental impact, local biodiversity, and the aesthetics of the area. List the criteria in order of most to least important and assign each to a related sub-problem. In the rationale column, explain why you placed your criteria in the order you selected. Constraints Criteria Rationale Which Sub-Problems does this criteria address? Section 3: For at least one of the sub-problems, propose two solutions based on the information from the lesson and your additional research. In the rationale column, explain how your solution restores the stability and biodiversity of your selected ecosystem. Sub-Problem Proposed Solutions Rationale Section 4: Answer the following analysis questions about your proposed solutions. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs?
Answer: how are we supposed to help you?
Explanation:
•Explain how Earth's history is divided in
the geologic time scale.
Answer:The geologic time scale is the “calendar” for events in Earth history. It subdivides all time into named units of abstract time called—in descending order of duration—eons, eras, periods, epochs, and ages.
Explanation:
juilo noticed that the soil in his garden no longer seemed aerated which component is most likely missing in his garden A fertilizer B herbicides C living Organisms D parent material
Living Organism, is the component which is most likely missing in his garden when the soil in his garden no longer seemed aerated.
What are Living Organisms?
An organism is a living thing with a well-organized structure that can respond to stimuli, reproduce, grow, adapt, and maintain homeostasis. An organism is thus any animal, plant, fungus, protist, bacterium, or archaeon found on Earth.
These organisms can be classified in a number of ways. One method is based on the number of cells that comprise it. The two major groups are single-celled organisms (such as bacteria, archaea, and protists) and multicellular organisms (animals and plants). Subcellular structures can also be used to classify organisms.
To learn more about Living organisms, visit: https://brainly.com/question/17259533
#SPJ1
Drag each label to the correct location. each label can be used more than once. identify whether each acquisition is allowable under eminent domain. yes no
Eminent Domain is the power of the federal government or state governments in the United States to acquire private property and convert it to public use. To accomplish this, the government must first compensate the landowner fairly for his or her property.
We can draw the following conclusions about the statements based on this concept:
Statement 1 is not permissible under Eminent Domain because a car showroom is not for public use.
Statement 2 is permissible because a radio tower would benefit society as a whole by providing telecommunications and broadcasting antennas.
Statement 3 is unconstitutional because it violates the landowner's right to just compensation for their property, which is guaranteed by the Fifth Amendment to the United States Constitution.
Statement 4 is allowable because it is benefit to people.
Identify whether each acquisition is allowable under eminent domain.
the local government wants to purchase the connolly families farmland in order to build a car showroom
the state government plans to purchase a local school building to build a radio tower
the federal government plans to take over mr.cooper's unused plot of land without any compensation to build a stadium
the state government plans to purchase a few occupied houses on behalf of a multinational corporation that wants to turn the land into a public park
learn more about eminent domain here
https://brainly.com/question/2093245
#SPJ4
Answer:
Explanation:
Help! which statement is true about the chemical elements found in living things?
A. Animal cells and plant cells contain very different elements.
B. all cells contain the elements carbon, nitrogen, hydrogen, and oxygen
C. unicellular organisms have different types of elements from multicellular organisms
D. only haploid cells contain hydrogen and carbon
Answer: The answer is B.
All living cells contain the same essential elements, such as carbon, nitrogen, and oxygen, according to a statement that is accurate regarding the kinds of chemical elements found in living cells.
What are macroelements, exactly?
The elements that living things need in large quantities are called macro-elements.
The growth and development of living cells are aided by these elements. These elements include, for instance:
Consequently, the statement that all living cells contain the same essential elements, such as carbon, nitrogen, and oxygen, is accurate regarding the kinds of chemical elements that can be found in living cells.
An infectious particle made only of a strand of DNA or RNA surrounded by a protein coat.
A virus is an infectious microbe that consists of a segment of nucleic acid (or DNA or RNA) surrounded by a protein coat. A virus cannot reproduce itself; Instead, it must infect cells and use components of the host cell to make copies of itself.
Capsid - A capsid is a protein shell surrounding a nucleic acid; together with the enclosed nucleic acid, it is called a nucleocapsid. This coat consists of proteins organized into subunits called capsomeres.
The virus is an infectious particle that reproduces by "commanding" the host cell and uses its machinery to produce more viruses. A virus consists of a DNA or RNA genome in a protein shell called a capsid.
read more about virus;
https://brainly.com/question/28060937
#SPJ4
How does rainfall occur in the rainforest?
Rainfall occurs when moisture in the atmosphere condenses and forms droplets of water. These droplets collect in clouds, and when the air can no longer hold them, they fall to the ground as rain.
Rainfall in the rainforest is affected by several climatic factors, such as temperature and humidity. In the rainforest, temperature and humidity levels are high, so there is a lot of evaporation from plants and animals, which adds to the moisture in the atmosphere. This moisture rises and forms clouds, and when the clouds get heavy enough, the water droplets fall as rain.
In addition to temperature and humidity, the amount of rainfall in the rainforest is also influenced by the topography of the area. Mountain ranges and valleys can act as barriers to rainfall, while low-lying areas can act as conduits for rain. The shape of the land can also affect the distribution of rainfall, as rain can be blocked by mountains and funneled into valleys, creating wetter and drier areas.
Learn more about Rainfall at : https://brainly.com/question/28576955
#SPJ4
Cancer consists of too much
O cell division.
O apoptosis.
O DNA replication.
O toxin production.
O translation.
Cancer consists of too much cell division.
Cancer is considered as uncontrolled cell growth. the main reason behind this uncontrolled cell growth is Mutations in genes that cause cancer by increasing the cell division rates or altering in normal controls on the important system, for example cell cycle arrest or programmed cell death. This uncontrolled mass can grow in the form of tumors in passing days .
Cancerous cells are considered to multiply very rapidly and don't mature at all , Because these cells don't work properly. They only tends to divide quickly and hence has more mistakes in their genes. Thus , Mutated genes don't work correctly reason is the instructions in their DNA are also altered.
Hence, a is correct option
To learn more about Cancer , here
brainly.com/question/14336972
#SPJ4
Damage to the corpora quadrigemina would interfere with..
-regulation of body temperature. conscious control of skeletal muscles.
-visual and auditory reflex movements of the head and neck.
-control of autonomic function.
control of breathing.
Damage to the corpora quadrigemina would interfere with Visual and auditory reflex movements of the head and neck.
The corpora quadrigemina, also known as the "quadruple bodies", are a group of four small rounded masses of gray matter located at the base of the brain. They are responsible for the processing of visual and auditory reflexes, which include movements of the head and eyes in response to visual and auditory stimuli. Damage to the corpora quadrigemina would impair the ability to respond to visual and auditory stimuli, resulting in difficulties with orienting the head and eyes towards a sound or light source.
The corpora quadrigemina also plays a role in the regulation of the autonomic nervous system (ANS) which controls the internal organs such as the heart, lungs and the digestive system. Damage to the corpora quadrigemina would affect the regulation of the ANS, which could lead to disturbances in the control of heart rate, blood pressure, and other functions.
To know more about brain
https://brainly.com/question/11950231
#SPJ4
Whale and fish relationship
Whales and barnacles are related, however the whales do not suffer any biological consequences from the barnacles' attachment.
The following are the causes of evolution are Overcoming ,Reproduction and Adaptation. The same function will be performed by species that originate from separate continents and coexist in the same habitat during the period of evolution, but having differing anatomical structures. The term "analogous organs" refers to these organs. The flipper and fin of fish have different structures but serve the same purposes, claims the inquiry. Their habitat determines the relationship between the two organisms. Whales and barnacles are related, however the whales do not suffer any biological consequences from the barnacles' attachment. Commensalism is the term for this kind of mutually beneficial arrangement.
To know more about fish on
https://brainly.com/question/15460521
An someone awnser all of theese i need it to revise work
11. The two main phases of the cell cycle are the cytokinetic phase and interphase. (False)
12. The phase in which a cell spends most of its life is interphase. (True)
13. During the mitotic phase, the nucleus divides. (True)
14. Some cells stop the cell cycle in the interphase GI stage. (True)
15. The period of growth and development in the cell cycle is called interphase. (True)
16. The process by which cells duplicates takes the same amount of time no matter which type of cells a duplicating. (False)
17. In mitosis, two different cells are being created. (True)
18. Sister chromatids are identical. (True)
19. Mitosis occurs in the following order: prophase - metaphase - telophase – anaphase. (False)
20. Cytokinesis is the final stage of cell division. (True)
Learn more about cell cycle
https://brainly.com/question/25282664
Type your response in the box.
More than 200 different types of cells exist in the human body. Why do you think these cells are important for various body functions? Explain your response.
Humans are multicellular, multifaceted entities. "Specialized" cells exist throughout our bodies. This indicates that each cell type has a distinct and particular purpose. As a result, each of the 200 different types of cells
how are humans differ to other animals ?
The most significant distinction between humans and animals is that people are motivated by logic and reason. They are capable of engaging in intellectual tasks. Animals, on the other hand, are entirely motivated by instincts. These are the main distinctions that distinguish animals from humans.
Humans are multicellular, multifaceted entities. "Specialized" cells exist throughout our bodies. This indicates that each cell type has a distinct and particular purpose. As a result, each of the 200 different types of cells in the body has a unique structure, size, form, and function, as well as a unique set of organelles.
To learn more about cells follow the given link: https://brainly.com/question/13920046
#SPJ1
Why can humans not rely on the transport method used in small organisms what can they do to overcome this
Humans cannot rely on the transport methods used in small organisms because we have much larger and more complex bodies that require specialized systems to transport materials such as oxygen, nutrients, and waste products.
Small organisms, such as single-celled organisms, can rely on diffusion, which is the movement of molecules from an area of high concentration to an area of low concentration, to transport materials throughout their body. However, diffusion is not efficient for larger organisms like humans, as the distance that materials need to travel is much greater.
To overcome this, humans have developed specialized transport systems such as the circulatory system and the respiratory system. The circulatory system, which includes the heart, blood vessels, and blood, is responsible for pumping oxygen and nutrients to the cells and removing waste products. The respiratory system, which includes the lungs, trachea, and bronchi, is responsible for getting oxygen into the body and getting rid of carbon dioxide. Additionally, humans have a complex nervous system which coordinates and controls all the vital functions of the body.
In summary, Humans rely on specialized transport systems like circulation, respiration, and nervous system to overcome the limitations of diffusion, which is the transport method used in small organisms.
To learn more about Human Resources, refer:
https://brainly.com/question/28668469
how do you the strand below is RNA and not a strand of DNA
AGUCAAGGCACUGGAG
A. the strand is too short to be DNA
B. There is no way to distinguish the two strands
C. the strand contains a U
We can determine that the strand AGUCAAGGCACUGGAG is RNA and not a strand of DNA because C. the strand contains a U.
What is the main difference between a DNA strand and an RNA strand?The main difference between a DNA strand and a RNA strand is the presence of Uracil or U as a nitrogen base in the RNA instead of Thymine or T base which are replaced during transcription.
Therefore, with this data, we can see that the major difference between DNA and RNA is the nitrogen base called Uracil in the first one.
Learn more about Uracil in RNA here:
https://brainly.com/question/923091
#SPJ1
What organelles perform the function of digesting old metabolic waste that takes up space and may be toxic to the cell? And what specific toxin do they eliminate?
Answer:
Other organelles like lysosomes are responsible for digesting and recycling toxic substances and waste. They are embedded with proteins called enzymes, which break down macromolecules, including amino acids, carbohydrates, and phospholipids.
Explanation:
what is the menchanism of natural selection
How many PAIRS of chromosomes are there in each of the body
a. Horse____
b. Mosquito____
c. Spinach____
d. Lily___
e. Human____
f. Housefly___
Answer: There are 23 pairs of chromosomes in the human body, meaning that we have 46 chromosomes in total. Different numbers of chromosomes can lead to health problems such as Down Syndrome. The only cells in our body that don’t have a pair of chromosomes are the reproductive cells, as these have a copy of all of our chromosomes.
Pairs of chromosomes in each of them:
a. Horse 31
b. Mosquito 3
c. Spinach 12
d. Lily 24
e. Human 23
f. Housefly 12
Horses have 31 pairs of autosomes (non-sex chromosomes) and one pair of sex chromosomes (X and Y). One copy of each chromosome comes from the father, and one copy comes from the dam. The foal can inherit one of four different chromosomal combinations from its parents.Mosquitoes have three pairs of chromosomes: two pairs of sex chromosomes (XX in females and XY in males) and two pairs of submetacentric autosomes.The Chenopodiaceae family includes cultivated spinach. It is a dioecious species with distinct male and female plants as well as sporadic monoecious plants with both male and female blooms. Spinach has 2n = 12 chromosomes, making it a diploid species genetically.This number is 24 in the case of lilies, 12 from the female parent and 12 from the male parent. Lilies with this number of chromosomes are referred to be diploid since it is a fixed number. Sometimes lilies with more chromosomes than usual develop due to a natural accident or human intervention.Normally, humans have 46 chromosomes overall, or 23 pairs of chromosomes. All of the genes for the body are found in chromosomes, which are composed of long strands of DNA.The housefly contains 12 diploid chromosomes in total, including two heterochromatic sex chromosomes and five pairs of autosomal chromosomes.
Learn more aboutChromosomes:
https://brainly.com/question/29786859
What type of energy is used to break the bonds in glucose?
To produce chemical energy in the form of ATP and NADH, regulated stepwise oxidation breaks down glucose and other dietary components.
What kind of energy dissociates the bonds in glucose?As glucose is broken down by oxygen during cellular respiration, chemical energy and heat are released.
What produces energy by glycolysis?Cellular respiration is the process through which stored energy is released and transformed into energy that your cells may utilise once glucose has been digested and transferred to your cells. The Krebs cycle, oxidative phosphorylation, and glycolysis are the three metabolic processes that make up cellular respiration.
To know more about glycolysis visit:-
https://brainly.com/question/15159050
#SPJ4
Name one thing that both the polyp and medusa forms of cnidarians have in common. chapter 16 reviuew
The majority of cnidarians have one of two fundamental body types: swimming medusae or sessile polyps. Both contain radially symmetrical mouths that are encircled by tentacles that carry cnidocytes. For breathing and digestion, both types have a single orifice and a cavity in their bodies.
How do the body shapes of medusas and polyps compare?Medusa are mobile whilst polyp are sessile. While medusa has a bell-shaped mouth that faces the water downward, polyp has a tubular form and its mouth faces the water upward.
What distinguishes a medusa from a cnidarian polyp?A polyp form, which is connected to a surface, and a medusa, which is an upside-down free-floating form, are the two main cnidarian body types. At various stages of their lives, some cnidarians change their appearance. cycle, while some live their entire lives in the same form.
To know more about cnidarians visit:-
brainly.com/question/3606056
#SPJ4
What are the 4 stages of the Calvin cycle?
The 4 stages of the Calvin cycle are:
Carbon Fixation: During this stage, carbon dioxide is taken in and combined with a five-carbon sugar molecule (ribulose bisphosphate) to form a six-carbon sugar molecule called glucose-6-phosphate.Reduction: The six-carbon sugar molecule is then reduced to form a three-carbon sugar molecule called glyceraldehyde 3-phosphate (G3P).Regeneration: This stage involves the use of energy from ATP and NADPH to regenerate the five-carbon sugar molecule used in the first stage.Synthesis: The energy from ATP and NADPH is used to convert the G3P molecules into various other molecules, such as amino acids and lipids, which are used to build other molecules in the cell.The Calvin cycle is the light-independent series of reactions in photosynthesis. It is also known as the dark reaction and the reductive pentose phosphate cycle.
It is a metabolic pathway that takes place in the stroma of chloroplasts and is part of photosynthesis, which converts carbon dioxide and water into glucose and other carbohydrates. The Calvin cycle uses the energy of ATP and NADPH produced during the light-dependent reactions to convert carbon dioxide into glucose.
Learn more about Calvin cycle:
https://brainly.com/question/842266
#SPJ4
what body made up of water is part of the crysophere
Answer:
The cryosphere is the frozen water part of the Earth system.
This includes frozen parts of the ocean, such as waters surrounding Antarctica and the Arctic.
Answer:
The cryosphere is the frozen water part of the Earth system.
Explanation:
This includes frozen parts of the ocean, such as waters surrounding Antarctica and the Arctic.
Which of the following best compares seedless vascular plants and nonflowering vascular plants? (2 points)
Both contain xylem and phloem, but seedless vascular plants reproduce sexually and nonflowering plants reproduce asexually.
Both reproduce sexually, but seedless vascular plants produce spores, and nonflowering vascular plants produce cones.
O Seedless vascular plants contain xylem and reproduce sexually, while nonflowering vascular plants contain xylem and phloem and reproduce asexually.
Seedless vascular plants can reproduce sexually or asexually, while nonflowering vascular plants lack flowers or fruit and reproduce asexually.
Answer: Both contain xylem and phloem, but seedless vascular plants reproduce sexually and nonflowering plants reproduce asexually.
Explanation: we are learning about this in biology right now.
In a group of leopards, some individuals have a spotted coat and others have a black coat. In this group, the gene for the coat pattern trait has two alleles. The allele A is for a spotted coat, and the allele a is for a black coat.
Sabrina, a leopard from this group, has a spotted coat. Sabrina has two alleles for a spotted coat.
Based on this information, what is Sabrina's genotype for the coat pattern gene?
AA
a spotted coat
Aa
a black coat
Answer: If I'm right it should be Aa, a black coat
Explanation:
Which of the following mechanisms will cause the gene pool of two populations to become similar?a.gene flowb.genetic driftc.mutationd.natural selection
Gene flow is the mechanism that causes the gene pool of two populations to become similar.
Gene flow is the process of transfer of genes in and out of a population. The new genes introduced into the population through gene flow then reproduce with the existing genes of the population and that is how the similarity of genes occurs.
Gene pool is the collection of the entire genome (genes and alleles) of a population whose organisms are able to reproduce. A large gene pool consists of varying genomic diversity which is considered to be able to adapt better in the unfavorable conditions.
To know more about gene flow, here
brainly.com/question/29992261
#SPJ4
What type of mutation in the CFTR gene causes cystic fibrosis?
The CF transmembrane conductance regulator protein is made using instructions from the CFTR gene (CFTR).
This protein serves as a conduit through the membrane of the cells that secrete digestive enzymes, perspiration, saliva, and mucus. The channel carries chloride ions, negatively charged particles, into and out of cells. Chloride ion transport aids in regulating tissue water flow, which is important for the creation of thin, freely flowing mucus. The lining of the lungs, digestive tract, reproductive system, and other organs and tissues are all lubricated and protected by mucus, a slick fluid.
Additionally, the sodium ion channels that move positively charged sodium ions across cell membranes are controlled by the CFTR protein.
Want to know more about cystic fibrosis visit the link which is given below;
https://brainly.com/question/14467649
#SPJ4
Can a community be both liveable and sustainable?
Answer:
livability is the part of sustainability relating to people being able to build a community in a specific place, time, and location. A sustainable community is not always livable.
What is a Livable Community?
A livable community can be one that cultivates diverse leadership and civic engagement, fosters a sense of community, connects people and resources, practices dialogue, embraces diversity, operationalizes racial justice and shapes its future.
What is the relationship between liveability and sustainability?
sustainability assumes an unchanging vision that joins economics,
livability is dynamic and evolves in response to shifting conditions and values.
How are grassland ecosystems most similar to forest ecosystems?
Both ecosystems are land habitats.
Both ecosystems are water habitats.
Both ecosystems are habitats for sharks and whales.
Both ecosystems are habitats for cactus and palm trees.
Even though both ecosystems are water habitats, grassland ecosystems resemble forests the most.
What is ecosystem?When plants, animals, and numerous other organisms engage with the world, weather, and other variables, an ecosystem is formed. An environment is a region where a circle of life is created by plants, birds, and some other organisms interacting with the weather, environment, and other factors. The basic types of ecosystems are forests, deserts, tropical rainforests, grasslands, tundra, savannas, and mountains.
Which five ecosystems rank highest?The five primary types of biomes are aquatic, grassland, forest, desert, and tundra, while a few of these are further subdivided into more specialized groupings, such as surface and groundwater, marine, pastures, tropical rainforests, temperate degradation, and taiga.
To know more about ecosystem visit:
https://brainly.com/question/21811049
#SPJ1
What are the 3 factors influencing flexibility?
The three most important factors influencing flexibility are environment, attitude, and skills.
First, environment plays a major role in influencing flexibility. It is important to create an environment that encourages change, innovation, and growth. This can come in the form of providing access to resources and support systems, as well as creating an atmosphere of collaboration and open communication. This type of environment encourages employees to be creative and willing to take risks, which is essential for developing flexibility.
Second, attitude is another factor that influences flexibility. Those who are open-minded, curious, and willing to explore new ideas are more likely to be flexible and adaptive. This attitude of openness encourages the development of new skills and helps to foster a culture of experimentation and learning. It is important to cultivate an attitude that is open to change and willing to explore new opportunities.
Learn more about flexibility at : https://brainly.com/question/10881309
#SPJ4
Natural selection acts only on traits that are _____.
Answer:
advantageous
Explanation:
advantageous in a certain environment
Answer: Heritable
Explanation: Natural selection only affects traits that are heritable