“The building is tall.”
A. The "is" of a part-whole relationship
B. The "is" of predication
C. The "is" of identity

Answers

Answer 1
The building is C- the “is” of identity

Related Questions

How did German territorial losses lead to World War II?

The Soviets were angry about not receiving territory, leading to expansion attempts in Eastern Europe.
Ethnic divisions in Czechoslovakia caused conflicts between competing international alliances.
Germans resented losing territory to the new Poland, which fueled nationalistic tendencies.
French grievances about Germany’s nonpayment of war damages caused France to demand more land.

Answers

The correct answer is C) Germans resented losing territory to the new Poland, which fueled nationalistic tendencies.

German territorial losses lead to World War II in that Germans resented losing territory to the new Poland, which fueled nationalistic tendencies.

After losing World War I, German was forced to accept the terms of the Treaty of Versailles. As part of the peace treaty, Germany was forced to give territory to Poland, Belgium, and Czechoslovakia. Of course, Germany was forced to pay reparations for the damage caused during the war.

These factors and the fact that the Weimer Republic did not work out as expected, created the conditions for the rise of the Nazi Party and the arrival of Adolph Hitler as the leader of Germany in 1933.

Answer:

C is correct, tried it

Explanation:

the market for yam is in equilibrium ,show how the following events will affect the market. 1. Research has shown that eating more yam cut the risk of cardiovascular diseases. 2. there is an increase in the cost of fertilizer​

Answers

Answer:

Scenario 1 ⇒ Demand for yam will increase.

If people found out that eating yams reduced the risk of them getting cardiovascular diseases, they would demand more of it so they can benefit from this reduced risk.

This will lead to a rise in price because the Demand curve will shift to the right and intersect with the Supply curve at a higher equilibrium price.

Scenario 2 ⇒ Supply of yam will decrease.

With the cost of fertilizer increasing, farmers of yam will have to incur more cost to be able to produce yams. They will therefore reduce their production levels so that they incur less cost thereby decreasing supply.

This decrease in production levels will lead to a rise in price because the supply curve will shift to the left and intersect with the Demand curve at a higher equilibrium price.


The routine mistreatment of people based on their social identity group is
called
OA. self-definition
OB. oppression
O C. socialization
OD. stereotyping

Answers

Answer:

the answer is B oppression

South Africa
NA
VE
Public Domain
Which of the following countries are compact states? (1 point)
O Malawi and South Africa
O Somalia and Liberia
O Nigeria and Liberia
O Cameroon and Somalia
O The Gambia and Malawi
will give brainliest!! please help

Answers

Answer: Nigeria and Liberia

Explanation:

A compact state is one where the distance from the center of the country is more or less the same to all the boundaries of the country.

Nigeria is a compact state with the center being in the capital of Abuja. Its compact nature allows for roads to be built easier. Liberia to the west of Africa is also a compact state with its shape being decided by European powers when they were scrambling for Africa in the Berlin Conference.

Which expression is a factor of x2 – 3x – 4?

Answers

Answer:

(x-4)(x+1)

Explanation:

Label colonies and settler colonies of the following states: Britain, France, Germany, Italy, Spain, Portugal, Belgium, Japan. Also include major resources that were gained from each colony. Next, label places that experienced economic imperialism (weren’t colonized but were controlled economically by other countries). Finally, label and describe at least 4 examples of anti-imperial resistance (one from India, one from China, one from somewhere in Africa, and one from the Americas). Hint: use your objectives to help you.

Answers

The below labelings and explanations are what is requested:

The Labels and Explanations

Great Britain owned both colonies and settler colonies, for example India, Australia, Canada, and South Africa.

The resources procured from these places encompass tea, cotton, diamonds, and gold.

French colonies situated in Africa, Southeast Asia, and the Caribbean facilitated the collection of rubber, oil, coffee, and sugar.

German colonies located in Africa, Asia, and the Pacific led to the harvesting of rubber, timber, and diamonds. Italy's colonial ownership in Africa and the Mediterranean yielded cotton and coffee.

Spanish rule in Latin America and the Philippines acquired gold, silver, and sugar, whereas Portugal's authority in Brazil, Africa, and Asia provided gold, diamonds, and spices.

As per Belgium's possessions in Africa, including the Congo, they gained access to rubber and ivory. Japan had control over Korea and Taiwan reaping coal and iron as a result. Furthermore, economic imperialism took place in China, Iran, Mexico, and Ethiopia while anti-imperial resistance was witnessed in India's Indian Rebellion of 1857, China's Boxer Rebellion of 1899-1901, Africa's Mau Mau Uprising, and Cuba's Revolution of 1959.

Read more about imperialism here:

https://brainly.com/question/377688

#SPJ1

TWO PARTS:
1. of the MSW generated in 2017, 61 million tonnes was recycled and 24 million tonnes was composted. what percentage of the total MSW generated was either recycled or composed?

2. a further 31 million tonnes of MSW was combusted for energy recovery. what percentage of MSW actually went to landfill in 2017?

Answers

1. The MSW generated in 2017, 61 million tons was recycled and 24 million tons was composted and approximately 22.41% of the MSW generated in 2017 went to landfill.

2.The 31 million tons of MSW was combusted for energy recovery and approximately 22.41% of the MSW generated in 2017 went to landfill.

To solve these questions, we need to calculate the total amount of Municipal Solid Waste (MSW) generated in 2017 and then determine the percentages of recycling, composting, energy recovery, and landfill disposal.

1. To calculate the percentage of MSW that was either recycled or composted:

  Total MSW generated = 61 million tonnes (recycled) + 24 million tonnes (composted)

  Total MSW generated = 85 million tonnes

  Percentage of MSW recycled or composted:

  ((61 million tonnes + 24 million tonnes) / 85 million tonnes) * 100 = 85.88%

  Therefore, approximately 85.88% of the total MSW generated was either recycled or composted.

2. To calculate the percentage of MSW that went to landfill in 2017:

  Total MSW disposed = 85 million tonnes (recycled and composted) + 31 million tonnes (combusted for energy recovery)

  Total MSW disposed = 116 million tonnes

  Percentage of MSW sent to landfill:

  ((116 million tonnes - (61 million tonnes + 24 million tonnes + 31 million tonnes)) / 116 million tonnes) * 100 = 22.41%

  Therefore, approximately 22.41% of the MSW generated in 2017 went to landfill.

It's worth noting that the calculations assume that all the recycled, composted, and combusted waste is diverted from landfill disposal.

However, in practice, there might be cases where a small portion of the recycled or composted waste still ends up in landfills. The percentages provided give a general understanding of the waste management practices but might not account for all nuances in waste disposal.

For more questions MSW, click on:

https://brainly.com/question/14665319

#SPJ8

could you also give the formula you used

Answers

The marginal cost of the sixth boat will be $2000.

How to calculate the marginal cost

In the question, we are told that the fixed and variable costs for 5 units of the sailboats are $4,000 each which equals $8000 in the summation.

Now for the sixth boat, the marginal cost can be obtained by subtracting the total cost for the 5 units with the new cost of $10,000. When we subtract the new cost from the old cost, we will get $2,000 and this is the marginal cost for the sixth boat.

Learn more about marginal costs here:

https://brainly.com/question/17230008

#SPJ1

Which type of query join is used within a single table?
O inner join
O outer join
O self join
O right join​

Answers

A query join used within a single table is Inner join

Psychology is the scientific study of human behavior and mental processes. Which of these research methods
are used most often by modern psychologists?
Select one:
a. Experimentation and observation
b. Causation studies
c. Interviews
d. Problem solving

Answers

Answer:

C. Interviews.

Explanation:

psychologists has an interview with patients and listening for an hour about what's the issue or consulting situation. He or She make questions to the patient and help him/ her to find a way to feel better or find a solution .

What do behaviorists emphasize in their approach to personality?

Answers

Answer:

Explanation:

Behavioral theorists view personality as significantly shaped and impacted by the reinforcements and consequences outside of the organism. People behave in a consistent manner based on prior learning.

A computer has generated a gender-neutral face for a video game character. How would adding an angry expression affect people’s perception of the face’s gender?
Anger would appear as feminine if subtle.
Anger would make the face appear male.
Anger would not affect perception of gender.
Anger would make the face appear female.
Anger would appear masculine if extreme.

Answers

C) Anger would not affect perception of gender

Ito ang unti unting paglipat ng kapangyarihan sa mga Pilipinong mamuno sa sariling bansa a. Pinasyon b. Batas jones c .Ang Saligang Batas ng 1935

Answers

Answer:

A. Pinasyon

Explanation:

#nasa pic ang explanation mga lodz

#carry on learning

Assume the United States economy is in short-run macroeconomic equilibrium at an output level greater than potential output.

Answers

(a) An increase in government spending by $100 billion will shift the AD curve to the right.

(b) Household savings will decrease by $400 billion in the short run.

(c) An increase in real output will lead to an increase in the demand for money in the economy.

(d) An increase in the interest rate in the short run leads to a decrease in the prices of previously issued bonds

(e) An increase in the inflation rate in the United States relative to the inflation rate in the European Union will lead to a decrease in the demand for dollars in the foreign exchange market.

(f) If the Federal Reserve attempts to keep the value of the dollar constant in the foreign exchange market, it should sell dollars and buy euros.

How to calculate the value

The maximum change in real output can be calculated using the formula:

∆Y = ∆Spending × (1 / (1 - MPC))

where MPC is the marginal propensity to consume.

∆Y = $100 billion × (1 / (1 - 0.8)) = $500 billion

The maximum change in household savings can be calculated as follows:

∆S = -MPC × ∆Y

∆S = -0.8 × $500 billion = -$400 billion

If the Federal Reserve attempts to keep the value of the dollar constant in the foreign exchange market, it should sell dollars and buy euros. This is because the dollar has depreciated in the foreign exchange market, and selling dollars will increase the demand for dollars and raise its value.

Learn more about saving on

https://brainly.com/question/25787382

#SPJ1

Attempt 1 of 2
Use the graph below to answer question 7.
Average Costs
18
14
10
Q
6
2
0
5
20
25
10 15
Quantity
Which of these firms is most likely to have an LRATC shaped like the one
shown above?
tiladi

Answers

Explanation:

ver un ratito la respuesta de esto sería una como de 20:30 Porque da lo mismo resultado como las otras Cómo es matemáticas pero son números

pesticides aee toxic to ___.

a) weeds
b) only pest insects
c) plants and animals
d) food crops
e) soil

Answers

Answer:

C - Plants and animals

Explanation:

According to research, pesticides can harm more than just “pests.” So, not only can they harm plants and animals, they can harm other people.

Answer:

Plants and Animals

Explanation:

I'm what sense can ethics be regarded as a system of knowledge?

Answers

A book of ehtics is a history system of knoledge

PLEASE HELP ASAP!


What must a person have in order to overcome a sense of helplessness that is associated with the repeated occurrence of negative events?

A sense of personal control
Learned helplessness
An ability to be introspective
Reciprocal determinism
An external locus of control

Answers

Answer:

The answer is "A sense of personal control

".

Explanation:

In the given question, the sense of personal control is also known as the intellectual connection with the friendly underlying conditions and enthusiastic trouble. It is an individual control for the discernment like one's reality is formed independently and activities. It must control the individual need to defeat feeling with the powerlessness which relates with the rehashed event of negative occasions.

Answer:

a sense of personal control

Between last year and this year, the CPI in Blueland rose from 100 to 110 and the CPI in Redland rose from 100 to 104. Blueland’s currency unit, the blue, was worth $0.75 (U.S.) last year and is worth $0.60 (U.S.) this year. Redland’s currency unit, the red, was worth $0.50 (U.S.) last year and is worth $0.40 (U.S.) this year. Consider Blueland as the home country.

a. Calculate Blueland’s nominal exchange rate with Redland.

Instructions: Enter your response rounded to one decimal place.

Last year:
blue
red/blue

This year:
red/blue


The percentage change in Blueland’s nominal exchange rate from last year to this year is:



Instructions: Enter your response as a whole number. Be certain to enter "0" if required.

%


b. Calculate Blueland’s real exchange rate with Redland.

Instructions: Enter your response rounded to two decimal places.

Last year:
red/blue

This year:
red/blue

The percentage change in Blueland’s real exchange rate with Redland from last year to this year is:

Instructions: Enter your response rounded to two decimal places. Be certain to enter "0" if required.

%

c. Relative to Redland, you expect Blueland’s exports to be
(Click to select)
by these changes in exchange rates.

Answers

When the CPI in Blueland rose from 100 to 110 and the CPI in Redland rose from 100 to 104, the nominal exchange rate of blue to red is 0.8333.

How to calculate the value

Nominal exchange rate = (Price of currency A in currency B) / (Price of currency A in home currency)

The price of the red in blue this year is:

Price of red in blue = 1 / (exchange rate of blue to red)

Exchange rate of blue to red last year = 1

Exchange rate of blue to red this year = 1.2

Now we can calculate the price of red in blue this year:

Price of red in blue this year = 1 / Exchange rate of blue to red this year = 1 / 1.2 = 0.8333

Therefore, the nominal exchange rate of blue to red is 0.8333.

Learn more about exchange on

https://brainly.com/question/10187894

#SPJ1

If f’(x) = 3 x^ 2 + 2x and f(2) = 3, then f(1) =

Answers

We can solve this problem using integration and the fundamental theorem of calculus. First, let's integrate f’(x):

∫f’(x) dx = ∫(3x^2 + 2x) dx
f(x) = x^3 + x^2 + C

To find the value of C, we can use the given condition f(2) = 3:

f(2) = 2^3 + 2^2 + C = 8 + 4 + C = 12 + C = 3
C = -9

Now we have the complete expression for f(x):

f(x) = x^3 + x^2 - 9

Finally, we can find f(1) by substituting x=1:

f(1) = 1^3 + 1^2 - 9 = 1 + 1 - 9 = -7

Therefore, f(1) = -7.

Complete the statement below.



In a neutralization reaction,
and hydroxide ions react to form
.

Answers

Answer:

Salt and water.

Explanation:

Neutralization is a chemical reaction in which acid and base are introduced together to form salt and water. In this reaction hydrogen + ions react with hydroxide - ions to form the salt. This is an exothermic reaction as heat is released during this chemical reaction.

Answer:

hydrogen and water

Explanation:

Compared to a short-term investment, a long-term investment is generally considered

Answers

Answer:

Compared to a short-term investment, a long-term investment is generally considered to have similar returns. to be equally as risky. to have greater risk. to offer lower returns

Explanation:

Answer:

The answer is C. to have greater risk

Explanation:

Rank the following regions from least developed (1) to most developed (10)

Answers

The following are ranked as follows using HDI.

Sub-Saharan AfricaSouth AsiaSoutheast AsiaMENA (Middle East and North Africa)Latin AmericaEastern Europe and Central AsiaOceaniaEast AsiaNorth AmericaWestern Europe.

What is the basis of the above ranking?

This rating is based on the Human Development Index (HDI), which considers things like life expectancy, education, and income. Other rankings may differ based on the indications and criteria employed.

The Human Development measure is a statistical composite measure combining data such as life expectancy, education, and per capita income that is used to classify nations into four levels of human development.

Learn more about HDI:
https://brainly.com/question/26788606
#SPJ1

I WILL GIVE BRAILY PLUS 20 points only if it is wrote out correctly and not just told what I already know ,
Im am becoming a psychologist and I need some help, I never as for help I help others. Any ways

the question is How will your attitude to the learning process help or hinder the achievment of your career goal?
Do you need to make some adjustments?
why or why not. you mess on my page just for points inwill report you.​

Answers

Answer:

1.it was on my attitude to the learning process but still its just based on the persons learning process, its just the same . pwede rin naman if you want to have the achievement of your career goal.

yes, sometimes i need some adjustments because you need to adjust that surrounds you not the others who needs to adjust wanna know why? it would be hard for you if theyre adjust , you need to be the first one to adjust if youre just new in that enviromment .

the answer is just based on my mind

btw sorry for grammatical errors. and wrong spells

Activity 2: Gathering information
2.1. Identify 3 current human rights violations to living in a safe and healthy way
in South Africa.
(3x1=3)

Answers

Three current human rights violations to living safely and healthily in South Africa are:

Gender-Based Violence (GBV): South Africa faces a pervasive problem of gender-based violence, including domestic violence, sexual assault, and femicide. Women and girls are particularly vulnerable to these violations, which have severe physical, psychological, and social consequences. GBV undermines the right to live free from violence and poses a significant barrier to a safe and healthy life for many in South Africa.

Access to Healthcare: Despite constitutional guarantees of the right to healthcare, South Africa faces challenges in ensuring equal and adequate access to healthcare services. Limited resources, unequal distribution of healthcare facilities, and socioeconomic disparities contribute to barriers to accessing quality healthcare, particularly for marginalized communities. The lack of accessible healthcare undermines the right to health and hinders individuals' ability to live a safe and healthy life.

Lack of Adequate Housing: Many South Africans face inadequate housing conditions, including informal settlements, shacks, and overcrowded living spaces. Lack of access to adequate housing violates the right to live in a safe and healthy environment. Inadequate housing exacerbates health risks, such as diseases, poor sanitation, and limited access to clean water and basic amenities. This contributes to the cycle of poverty and compromises individuals' well-being.

These violations highlight the need for concerted efforts by the South African government, civil society organizations, and international partners to address gender-based violence, improve healthcare accessibility, and ensure adequate housing for all citizens. Upholding these human rights is crucial for creating a society where individuals can live in safety and enjoy their health.

Explain ONE cultural or economic development in the late twentieth century that would explain Barton’s argument about the “impending decline of the West” in the second paragraph.

Answers

One educational incident that keeps expounding Barton's debate about the "forthcoming decline of the West" is the rise of pluralism and the deterioration of a joint sense of Western similarity.

How does this help Barton's debate?

As nations enhanced more various, the usual educational principles and ideas that were based on Western culture were progressively questioned. \

\This, in proper sequence, experienced to a despondency in Western organizations and a increasing sense of doubt about the future.

Additionally, financial worldwide integration and the shift of business-related capacity from the West to arising markets like China too provided to Barton's debate about the decline of the West.

Read more about economic development here:

https://brainly.com/question/25017714

#SPJ1

What proofreading and revision suggestions did you make to improve the writing sample? How did this process help you become a better writer?

Answers

The proof reading and suggestions for improving a writing sample are:
Correcting grammar and punctuation errors, improving sentence structure and clarity, and enhancing vocabulary and word choice in the writing sample.

Why is this so?

By identifying and correcting grammar and punctuation errors, the writing became more grammatically correct and easier to understand.

Improving sentence structure and clarity involved rephrasing or rearranging sentences to enhance readability and eliminate unnecessary words or phrases.

Enhancing vocabulary and word choice expanded my linguistic repertoire and made my writing more sophisticated and engaging. By honing my writing skills, I am better equipped to convey ideas effectively and engage readers, improving my overall writing ability.

Learn more about proof reading at:

https://brainly.com/question/1446405

#SPJ1

How did coal mining affect the development of the steam locomotive? please put detail into answer

Answers

Answer:

The steam locomotive changed transportation by allowing us to ship goods and travel faster than ever before. It gave us the ability to create new industries and mold transport into what it has become today. The steam locomotive was an icon of the industrial revolution in many countries throughout the world.

Explanation:

why does school exist?

Answers

If this is an actual question then ...
Why school as a concept, our schools in particular and our classrooms exist is a matter of great importance to designing classrooms that teach (higher order thinking) skills and successfully challenge students. We do it so we can challenge students' existing skills and help them grow as a result.

If not then it’s because people want to hurt us by making us go to school.

Answer:

Explanation:

If this is a real question the the answer is that we are teachers for reasons bigger than ourselves: to develop our community, to break generational poverty, to develop mutual respect and thinking and reasoning skills, to help students grow, and to transform their thinking and their knowledge and their ability into something greater

if not then people want us to depressed all day everyday

Which of the following is an example of a spontaneous conversation?
OA child asking a question as they're getting ready for bed
O Parents doing a daily school agenda check
OA parent and teen having a serious conversation
O A family discussing a challenging and difficult topic

Answers

Answer:

D

Explanation:

Other Questions
A patient undergoes a laparoscopic cholecystectomy. Which code would support medical necessity for this procedure?K74.60K35.80K81.0N20.0 For a small business producing a single product, having one location and few employees, the organizational structure that is most appropriate is:a) Centralized.b) Decentralized.c) Divisional stability.d) Segmented decision making. echoing, restating, and seeking clarification of what a person expresses (verbally or nonverbally) in a therapy session is called Which statement describes a difference between cliques and crowds?A) Cliques involve more members than crowds.B) Older adolescents are more likely to belong to cliques than to crowds.C) Cliques are assigned by consensus of the peer group.D) Members of a crowd may spend little time with other members. Amit is a college student who is having trouble budgeting any money for savings. What is something he can do to stretch his budget a little to start saving money for his future?a. He can buy a house, setting aside the money he would have spent on rent.b. He can buy his coffee at Starbucks, setting aside the money he would have spent on a coffee machine and bags of coffee.c. He can take a student loan, setting aside the money he would have spent on tuition and books.d. He can prepare and eat more meals at home, setting aside the money he would have spent as restaurants. within the decentralization concept of delegating authority and responsibility, which is not a responsibility center? group of answer choices investment center profit center revenue center cost center Buchanan Corp. is refunding $12 million worth of 11% debt. The new bonds will be issued for 7%. The corporation's tax rate is 33%. The call premium is 8%. What is the net cost of the call premium?Which is the correct answera. $647,700b. $643,200c. $658,200d. $678,200 The 5 things I have learned in Ms PowerPoint FILL THE BLANK. according to your reading, since the mid-1990s the policy used on the us-mexico border has been known as _____________________, driving hopeful migrants into the hostile terrain of the desert. The Secretary of State often responds first to international crises by coordinating, aiding, negotiating, and attempting to influence the outcome of events.A. True B. False Write the equation for the following story: jadas teacher fills a travel bag with 5 copies of a textbook. the weight of the bag and books is 17 pounds. the empty travel bag weighs 3 pounds From the point of view of economic efficiency, output in a monopolized market is a. too high. b. perfect. c. too low. d. undesirable. FILL IN THE BLANK.The ______ is the connection from a home or business to the telephone company end office. the target date funds used as examples in class tended to invest in index mutual funds like the total u.s. stock market and the total world stock market and a bond index fund. True or False Segn el artculo, qu representa el merengue para la Repblica Dominicana?Es un ritmo que tiene sus orgenes en la actualidad Malik finds some nickels and quarters in his change purse. How many coins does he have if he has 5 nickels and 4 quarters? How many coins does he have if he has x nickels and y quarters? consider a binary liquid mixture for which the excess gibbs free energy is given by ge/rt= ax1x2(x1 2x2). what is the minimum value of a for which liquid-liquid equilibrium (lle) use the common tangent construction to determine the activity of pb in systems with the following compositions at 200 c. please give a numerical value for activity. write the equations in cylindrical coordinates. (a) 9x2 2x 9y2 z2 = 1 (b) z = 2x2 2y2 The sequence of part of an mRNA transcript is 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3' What is the sequence of the DNA coding strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG