What are the top three characteristics of an effective presenter Why are these characteristics so important?

Answers

Answer 1

You need to [1] be knowledgeable about your subject matter, [2] be assured, and [3] be self-aware if you want to be a good presenter or even just get through your upcoming presentation .

How would you define presentation?

A presentation allows a speaker to solicit feedback from an audience. A presentation typically aims to inform, persuade, urge, encourage, foster goodwill, or propose a novel concept or service. Speeches, introductions, lectures, and demonstrations are all examples of presentations.

What are the presentation's three a's?

The audience hook, answer, agenda, and action request are collectively known as the "4 A's." Together, they offer an excellent tool that we teach in our on-site presentation training class for properly framing remarks for your listeners.

To know more about presentation  visit:

https://brainly.com/question/27696351

#SPJ4


Related Questions

What are the three types of conflicts explain two types using relevant examples?

Answers

The three types of conflicts are intrapersonal, interpersonal, and social.

Intrapersonal conflicts are conflicts that take place within oneself, such as struggles with identity or making difficult decisions. For example, an intrapersonal conflict may arise when an individual is torn between pursuing a safe, stable career they’re not passionate about or taking a risk to pursue their dream job.

Interpersonal conflicts are those between two people or groups. This may include arguments, disagreements, power struggles, competition, or even physical altercations.

For example, if two people have a disagreement about a project at work, they must come to a resolution that both parties are comfortable with in order to move forward.

Lastly, social conflicts are those between larger groups or society as a whole. This may include class struggles, religious disputes, and political and ideological differences.

For example, the conflict between pro-life and pro-choice activists is a social conflict. Here, the two sides are at odds over differing beliefs and values and must come to a resolution that both sides agree on in order to move forward.

For more questions like Conflicts click the link below:

https://brainly.com/question/14838741

#SPJ4

What is the supporting details in first paragraph?

Answers

Major and minor supporting details come in two different categories.

The fundamental structure of a paragraph is made up of the main concept and its major supporting components. The fundamental points that bolster the core notion are the major specifics. Smaller information are frequently included in paragraphs. The supporting elements are expanded upon by the key details, which explain and further develop the core notion.

EXAMPLE: Key Concept and Major Detail

According to studies, a person's first name might affect them.

Some names have a favourable connotation for the bearer. However, other names might be detrimental.

Example: Key Concept, Major Point, and Minor Point

According to studies, a person's first name might affect them.

Some names have a favourable connotation for the bearer. For instance, a poll revealed that American males find names like Susan to be quite seductive. Additionally, participants in a British survey believed that Tony was the name of a particularly amiable person. However, other names might be detrimental. In one study, teachers, for example, gave essays purportedly written by boys named Hubert and Elmer lower grades than they gave the exact same essay when they credited lads with more well-known names. According to a different study, girls with less popular names performed worse on IQ and achievement tests than those with names that are more endearing.

To learn more about supporting details in first paragraph, refer: https://brainly.com/question/19805865

#SPJ4

__________________________________________
I am that gadfly which God has given the state, and all day long and in all places am always fastening upon you, arousing and persuading and reproaching you.
__________________________________________
Based on the context, what does the word reproaching in this excerpt from The Apology most likely mean?
A.escaping from
B.causing injury
C.expressing disapproval

Answers

Based on the context, the word 'reproaching' in this excerpt from 'The Apology' means (C) expressing disapproval.

The Given Context of 'The Apology'

Socrates describes his place in Athenian society through this context of "The Apology". He had been sentenced to sui-cide after being accused of influencing young people. However, he is defending his position as a philosopher by asserting that it is he who constantly reminds the people and the government of their obligations. According to him, it is his duty to always be "arousing and persuading, and reproaching" people.Thus, here the word 'reproaching' most likely means expressing disapproval.

To learn more about 'The Apology' from the given link

https://brainly.com/question/7988928

#SPJ4

(01.04 LC)
Which rhetorical device matches the definition: a figure of speech where a part is made to represent the whole or vice versa?
O Asyndeton
Chiasmus
OSynecdoche
Zeugma

Answers

The rhetorical device that matches the definition provided is C. Synecdoche

What are rhetorical devices and what is Synecdoche?

When writing or speaking, a rhetorical device is a strategy or tactic intended to elicit a specific response from the audience. They are employed to convince, educate, or amuse the audience.

Synecdoche is a figure of speech in which a part of something is used to represent the whole, or vice versa. It is a type of metonymy, which is a figure of speech in which a word or phrase is replaced with another word or phrase that is closely related to it. An example of synecdoche would be using "wheels" to refer to a "car," or "the White House" to refer to the President and their administration.

Find more information on rhetorical devices here;

https://brainly.com/question/19264317

#SPJ1

Explain how the PMRC changed its "original suggestions" to the music industry in regard to record labeling. Use two details from the passage to support your answer. Use RACE

Answers

Note that the PMRC (Parents Music Resource Center) presented various record labeling ideas to the music business, although these suggestions altered over time. Here are two examples of revisions to their initial suggestions:

It developed a "Adult Warning" label for songs with explicit content; andRecord labels are now required to use a labeling scheme.

What is the origin of PMRC (Parents Music Resource Center)?

The Parents Music Resource Center (PMRC) was an American group founded in 1985 with the claimed objective of strengthening parental control over children's access to music with violent, drug-related, or explicit themes through the use of Parental Advisory stickers on records.

The committee was created by four ladies known as the "Washington Wives," referring to their husbands' official ties in the Washington, D.C. region.

Tipper Gore, wife of Senator and subsequently Vice President Al Gore; Susan Baker, wife of Treasury Secretary James Baker; Pam Howar, wife of Washington realtor Raymond Howar; and Sally Nevius, wife of former Washington City Council Chairman John Nevius are the women who formed the PMRC.

Learn more about music business:
https://brainly.com/question/29577610?
#SPJ1

where the plans for jimmy cross fantasy for lavender's death for the days after ?

Answers

Jimmy Cross’s fantasy for Lavender’s death was to have a celebration of his life.

were were the ideas for Jimmy Cross's fantasy of the days following Lavender's death?He wanted to have a bonfire, toasted marshmallows, a picnic in the woods, and for everyone to tell stories about Lavender. He also wanted someone to give a speech about his bravery and selflessness.In the days after his death, Jimmy Cross wanted to create a memorial for Lavender in the form of a stone monument or a tree planted in his memory.Jimmy Cross's fantasy for Lavender's death was to imagine him being remembered as a hero. He wanted to believe that Lavender died while heroically protecting his fellow soldiers, that he had done something brave and honorable in his last moments.He imagined that Lavender's death would be remembered and talked about for days after, and that the men in his platoon would have a greater appreciation of their lives because of it.He hoped that Lavender's death would bring them all closer together, and that it would make them think about their own mortality and make them strive to be better men.He wanted Lavender's death to be something that was remembered and talked about for days, weeks, and years after, so that his memory would live on and his heroic actions would be remembered.

To learn more about jimmy cross fantasy refer to:

https://brainly.com/question/30205017

#SPJ1

the sons of liberty was

Answers

Answer: Sons of Liberty, organization formed in the American colonies in the summer of 1765 to oppose the Stamp Act.

Explanation:

Read the entence from the paage. Dyed plant fiber have been found at Dzudzuana Cave in Georgia, dating back to 30,000 year ago. A good paraphrae of thi entence hould include
A. How the dyed plant fiber were located within the different cave. B. The type of dye made from plant fiber thouand of year ago. C. The type of plant fiber found in Dzudzuana Cave in Georgia. D. How old the dyed plant fiber are at Dzudzuana Cave in Georgia. Reet Submit

Answers

At Dzudzuana Cave in Georgia, dyed plant fiber from 30,000 years old has been discovered. How old the plant fibers at Georgia's Dzudzuana Cave are might be an excellent addition to a solid paraphrase of this sentence.

Georgia is a transcontinental country located at the meeting point of Eastern Europe and Western Asia. It is a portion of the Caucasus region, which is bounded by Armenia to the south and southeast, the Black Sea to the west, Russia to the north and northeast, Turkey to the southwest, and the Black Sea to the west. The country's 69,700 square kilometer land area is home to 3.7 million people. About one-third of Georgians reside in Tbilisi, the country's capital and largest city. In what is now Georgia, several independent kingdoms, such as Colchis and Iberia, were founded during the ancient era. Early in the fourth century, ethnic Georgians formally converted to Christianity, which contributed in the spiritual and political.

Learn more about Georgia from

brainly.com/question/152156

#SPJ4

Find 3 quotes from book Love from A-Z
In your own words explantations no copy and paste.

Answers

Three quotes from the book, "Love from A-Z" are:

“Never, ever quake in the face of hate, Zayneb.”“Make sure that you make the beginning of whatever you begin beautiful.”“Your resistance to my existence is futile.”What is a quote?

A quote refers to a direct statement that is made by another author or individual. They are often enclosed in quotation marks to show that they are not the direct words of the writer.

The first quotation from the book, "Love from A-Z" was an encouragement by S.K Ali for Zayneb to never give in to fear in the face of hatred. This encouragement will help her to maintain her courage despite the response she got from people.

The second quote is another piece of advice to ensure that whatever is worth doing is worth doing well. Lastly, a strong statement is made by S. K. Ali to show that he was dampened by those who opposed him.

Learn more about quotes here:

https://brainly.com/question/2762082

#SPJ1

why did the founding fathers select this method instead of the popular vote

Answers

Answer:

Because...

Explanation:

The system has powers of each branch, and they would be used to check the powers of the other two branches.

Why are the Elgin Marbles so called?

Answers

Elgin marbles are named after Thomas Bruce, 7th Earl of Elgin, who from 1801 to 1812 oversaw the removal of marbles from the Parthenon, Erechtheion, Temple of Athena Nike and Propylaea and their shipment to England.

The Elgin Marbles are a collection of Ancient Greek sculptures from the Parthenon and other monuments on Athens' Acropolis that were brought to Britain by agents of Thomas Bruce, 7th Earl of Elgin, from Ottoman Greece and are currently housed in the British Museum.

The bulk of the statues were commissioned in the 5th century BCE by artist and architect Phidias. The phrase Parthenon Marbles or Parthenon Sculptures refers to sculptures from the Parthenon's frieze, metopes, and pediments that are housed in various institutions, primarily the British Museum and the Acropolis Museum.

To know more about Elgin Marbles here-

https://brainly.com/question/30124775

#SPJ4

Complete a film review on Misery.  Your review needs to include at least 3 film terms. Please highlight the terms you use. Review must be at least 10 lines and in MLA Format.

Choreography
Musical
Film score
Dialogue
Character actor
Storyboard
Special effects
Computer generated imagery
Screenplay
Mise-en-scene
Montage
suspense
Tracking shot
Wide angle shot
Establishing shot
Reverse angle shot
Juxtaposition

Answers

James Caan, Kathy Bates, and Frances Sternhagen feature in the suspenseful film Misery.

What is a movie review?

Film reviews are typically written by journalists or other non-academics for the general public and published in newspapers, magazines, or online around the time the film is shown in theatres.

Unquestionably one of the best movies of the 1990s, and in my opinion the best movie adaptation of Stephen King's work is Misery. This is TRUE horror; there are no monsters or elaborate special effects; instead, Kathy Bates, who played one of the scariest villains in horror film history, has achieved true stardom.

Hence/Therefore,

To learn more about Films from the given link

https://brainly.com/question/5401496

#SPJ1

What is a benefit of a multi-party system in Blockchain?

Answers

Supply chains become collaborative supply networks with increased agility and resilience thanks to multi party system is a benefit of a multi-party system in Blockchain.

Supply chains are transformed into cooperative supply networks via multiparty systems, which enhance their agility and resilience. enabling data standardization across organizations. Introducing token features that enable the creation of digital twins of physical assets, the transfer of value, the creation of tokenized incentives, and the fractionalization of ownership of assets. Blockchain helps build confidence in multi-party systems by enabling transparency, decentralized control, and an immutable record of transactions, which enhances security and responsibility between participants.

To learn more about multi-party systems Please click on the given link:

https://brainly.com/question/30166259

#SPJ4

Flashback is a tool used by
authors to
A. supply detail and information about
other stories they have written.
B. share their purpose for writing their
story
and to relay their message to the readers.
C. supply detail a reader needs after
the story has already begun.

Answers

Authors utilise flashback as a tool to explain to readers why they chose to write a certain story and to convey their point.

What does a film flashback serve as?

Flashbacks are frequently utilised to fill in important backstory by recalling incidents that occurred before the story's main sequence of events. A flashforward (also known as a prolepsis) reveals future events going the other way.

What literary device is the flashback?

A chronological narrative can be moved from the present to a scene in the past using the mechanism of flashback. Flashbacks are frequently abrupt interjections that add background knowledge and memories to stories or characters to help explain them.

To know more about Flashback visit:-

brainly.com/question/14424958

#SPJ1

2. In the phrase, "Cassie tried to study for her math quiz," what is the antecedent?

Answers

In the phrase, "Cassie tried to study for her math quiz," her is the antecedent.

The word antecedent means “ before. ” In English alphabet, the description of antecedent is a expression, word, or clause indicated by apronoun.However, you will need to include an antecedent with it, If there is a pronoun in a standalone judgment .

In grammer, a phrase — called expression in some surrounds is a group of words or singular word acting as a grammatical unit. For case, the English expression" the veritably happy squirrel" is a noun expression which contains the adjective expression" veritably happy". Expressions can correspond of a single word or a complete judgment .

To learn more about antecedent here

brainly.com/question/24734058

#SPJ4

How did Mr Wright treat Mrs Wright?

Answers

In "Trifles," Mr. Wright wrongs Mrs. Wright three times. In addition to robbing her of her youth and locking her up, he also cut her off from her family and friends, gave her no love, and killed her sole friend, the singing Canary.

What are Trifles?

Susan Glaspell wrote a one-act drama titled Trifles. On August 8, 1916, the Provincetown Players gave it its debut performance at the Wharf Theatre at Provincetown, Massachusetts. Glaspell portrayed Mrs. Hale on the first performance. The play is regularly cited in textbooks on American literature. The play contrasts how women act both in public and in private, as well as how they perform before a group of women vs how they perform in front of males. It was written during the initial wave feminist movement. The murder of John Hossack, which Glaspell covered as a journalist for Des Moines Daily News, is a loose inspiration for the play.

To know more about Trifles visit:

https://brainly.com/question/30131878

#SPJ4

1. Explain why the scholarship jacket is the narrator's "only choice" of scholarship.

Answers

By telling them a personal tale, the narrator point of view establishes a connection with the audience. A story—and the storyteller—becomes credible by drawing the reader in this way.

What is the term "peripheral point of view"?

The narrator of a "first person peripheral" narrative is a different character who observes the story's main character and reports what they see to the reader. Though he may be involved in the action, the ancillary narrator is not the main subject of the story.

The author suggests that the Neolithic volcanic outburst was most likely located where?

According to the text, the mural was discovered at the Neolithic atalhöyük site in Central Anatolia, Turkey, and purports to depict an eruption of the Hasan Da twin-peaks volcano, which is situated about 130 km northeast of atalhöyük.

To know more about narrator point of view visit :-

https://brainly.com/question/2786391

#SPJ1

What do the last two lines of Ode on a Grecian Urn mean?

Answers

Literary scholars frequently argue the poem's final two lines, "Beauty is truth, truth beauty,—that is all  Ye know on earth, and all ye need to know." These words are said by the "Grecian urn," personified. Inferred from these statements is that beauty and truth go hand in hand.

The final two lines of "Ode on a Grecian" are what?

The final two words, "'Beauty is truth, truth beauty,'—that is all Ye know on earth, and all ye need to know," are mysterious, and their meaning has long been a source of discussion.

What verse is in Ode on a Grecian Urn's third stanza?

more joyous, joyous love! Forever panting and youthful, Forever warm and still to be enjoyed; That leaves a heart high-sorrowful and cloy'd, a scorching brow, and a parching tongue, all breathing human desire far above.

To know more about Grecian Urn visit:-

https://brainly.com/question/30122760

#SPJ4.

How do you use in a sentence?

Answers

In a sentence, the word order is Subjects + Action + Object. He (subject) received his degree (verb) (object).

How should a sentence be written?

When a sentence has a subject and a verb, it is complete. One can understand a complete statement on its own. Every sentence needs a topic, which often comes first in the sentence. A subject might be a pronoun or a noun. A subject might be a pronoun or a noun.

How are dashes used in sentences?

To avoid confusion between the beginning and ending of a series and the rest of the clause, use dashes. The husband, the priest, and the jockey are three examples of outstanding female characters. Dots are also used in dialogue to indicate when a sentence has been cut off: Instance.

To know more about sentence visit:

https://brainly.com/question/18728726

#SPJ4

Where did Darwin collect similar but different species of birds during his travels?

Answers

On Galapagos Islands, he collected a sizable number of finch specimens. In notes and on these specimens, Darwin recorded his findings as he developed theory of evolution through natural selection.

What are observations exactly?

The active gathering of data from the a primary source is observation. One must use their senses to examine living things.

Using scientific equipment to see and record data is another way to employ observation in science. Additionally, the word may be used to denote any knowledge acquired for the scientific pursuit.

Depending if a numerical value is assigned to the occurrence by counting or quantifying them, observation can be either quantitative or qualitative. Qualitative observations just note if a quality is present or not.

To learn more about observations refer to:

brainly.com/question/584814

#SPJ4

Which answer choice defines a run-on sentence? (1 point)
O an incomplete sentence without a subject or a verb
O a clause that does not stand on its own as a sentence
O a sentence that has two independent clauses not joined properly
O a word used to connect clauses

Answers

Answer:

C: a sentence that has two independent clauses not joined properly defines a run-on sentence.

2. In the chapter called "Going Home Again" on page 189, what is the reason why Roman is in the hospital?

Answers

Answer:

going home again

What is wartime mobilization?

Answers

The organisation of a country's armed forces for active military service during a war or other national emergency is known as mobilisation, in war or national defence.

Why is project mobilization important?

You can discover staffing bottlenecks with the help of the project mobilisation plan, and as a result of your strategy, your company management may need to choose between postponing the project or keeping it on time while postponing another company effort. Orders for mobilisation are solely for active duty and do not permit demobilisation. An independent set of demobilisation orders will be issued by PERS-461. Without having demobilisation orders in hand, the reserve member is not permitted to leave their gaining or supported command.

What are benefits of community mobilization?

The sharing of financing and resources, improved problem-solving, better representation of community views, and accountability are all advantages of community mobilisation. All employees are accountable for taking part in the mobilisation of resources to support established priorities, especially through offering suggestions for project development. However, this process is intended to be led by senior managers.

To know more about Mobilization visit:

https://brainly.com/question/29643253

#SPJ4

What makes a cathedral different from other churches?

Answers

A cathedral is a church that a bishop oversees; it serves as the main church within a diocese.

What sets a church apart from a cathedral?Churches are more commonly referred to as churches and are places of Christian worship rather than the residence of a bishop, which is designated as a cathedral. Catholics frequently refer to different places of Christian worship by the terms "cathedral" and "church."A cathedral is a church that a bishop oversees; it serves as the main church within a diocese, the geographical region that a bishop has control over. Its name comes from the cathedra, a particular chair used by bishops.The bishop's residence is a cathedral, which also serves as a place of prayer and outreach.

To learn more about  cathedral refer to:

https://brainly.com/question/2377389

#SPJ4

Orwell uses an extended metaphor in paragraphs 7-10. What are the specifics of the metaphor, and what is it a metaphor for? From essay “shooting an elephant.

Answers

Orwell employs use simile to refer to inanimate objects in the chapter where the elephant is slaughtered, comparing the corpse to "a large rock" and the trunk to "a tree."

Orwell writes, "The crowd grew very silent, and a deep, low, pleased sigh, as of people who watch the play curtain go up at last, exhaled from countless throats" when describing the moment in which he shoots the elephant.

The hushed audience and the mention of the drawn curtain are overt allusions to theater. Orwell has previously said that he felt obligated to serve the Burmese people in his capacity as a colonial police officer. This section illustrates the interaction between the performer and the audience.

Learn to know more about metaphor:

https://brainly.com/question/9418370

#SPJ1

What are some similarities of driving in the summer and driving in the winter?

Answers

Answer:

you have to use a steering wheel

Explanation:

this is because it comes in the car

Review chapter 11, on page 3. Which conclusion can be drawn from the narrators address to the reader in this part of the story

Answers

Answer:

love

Explanation:

What was the biggest main problem with the Articles of Confederation?

Answers

It had a weak central government causing it to fall apart

2
Select the correct answer.
Which statement describes an example of logical evidence?
O A.
OB.
O C.
Texts: Mastery Test
O D.
a historical document showing the date a local business was established
a speaker's story about a personal experience at a local business
a statistic showing the most successful local business
a speaker's conclusion based on statistics about local businesses

Answers

A statistic showing the most successful local business describes an example of logical evidence.

What is business?
Business
is an activity or enterprise that involves the exchange of goods, services, or both for money or other compensation. It is typically conducted within a particular geographical area or between individuals living in different countries. Businesses can be categorized according to the goods or services they offer, the type of customer they serve, the production process, and their size. Business is an important part of the economic system, providing employment opportunities, income, and a means of production for goods and services.

To learn more about business
https://brainly.com/question/24448358

#SPJ1

What is an example paragraph?

Answers

When we need to demonstrate or elucidate anything, such as a thing, a person, an idea, or a situation, the explanation paragraph is helpful. When we exhibit, we do so while calling attention to how something is.

What are paragraphs and examples of them?

An structured, cogent succession of statements that are all connected to the same idea is a paragraph. Almost all of your work that is more than a few lines needs to be divided into paragraphs.

What is a writing example?

Example (or exemplification) is a paragraph or essay development technique used in writing when a writer uses narrative or instructive details to clarify, explain, or justify a point.

To know more about Paragraph, visit:
https://brainly.com/question/27073860

#SPJ4

Other Questions
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method Lupe wrote two different fractions with the same denominator. both fractions were less than 1. can their sum equal? can their sum be greater than 1? What number would you need to multiply the first equation by to eliminate the y variable when solving the system of equations by elimination? In three complete sentences, describe how i should find the solution to the system of equations below. -6x + 3y = -12x - y = 14 I have x N50 note and y N100 note. There are eight note altogether and their total value i N550. How many of each note do I have? What is the importance of mitosis for uni cellular organisms? Which sentence best describes how the setting contributes to the theme of appearance versus reality? If 16 inches of ribbon costs $2.08, how much will 36 inches ofribbon cost? Show your thinking. Use figurative language to describe each of your provided words. You will write one sentence for each word, and put the type of figurative language used in parentheses at the end of the sentence. Underline your word. Look at the example below to help you!The rainbow was a beautiful blanket, arching over the sky. (metaphor)clientadvertisementmemorizesidewaysexercisevarietyinquiresciencedialoguelibrary How is judicial activism connected to the idea of a loose interpretation of the US Constitution? ( x - 4 ) + ( 2x - 7 ) - find the Sum or Difference :) what was the main source of radio exposure for indie rock in the 1990s? In science, one example of a theory is the cell theory. If a scientist collects evidence that questions the basics of a scientific theory, this means the theory is Is (-1, 0) a solution to this inequality? Why does one of the British soldiers inside Coleman's Inn reject the idea that Will might have brought the horses with him