Which client is considered at risk for skin alterations?

Answers

Answer 1

Answer: People who don't wear sunscreen or are around a lot of radiation.

Explanation: I am 99% sure that is the right answer.

Answer 2

Pressure, shear, and friction from immobility put an individual at risk for altered skin integrity. Patients who are overweight, paralyzed, with spinal cord injuries, those who are bedridden and confined to wheelchairs, and those with edema are also at highest risk for altered skin integrity.


Related Questions

Which procedure is being applied in the follow up study of children who displayed high anxiety symtoms?

Answers

The procedure  that is known to being applied in the follow up study of children who displayed high anxiety symptoms is known as option D: Operant conditioning.

What is meant by operant conditioning in psychology?

Operant conditioning is a term that is often called instrumental conditioning.

It is regarded as  a kind of  process where humans and animals are said to learn how they can behave in a way as to be able to get a rewards and also to avoid punishments.

Note that It is also the name for an experimental psychology where there is such learning and action selection acts are been studied.

Therefore note that The procedure  that is known to being applied in the follow up study of children who displayed high anxiety symptoms is known as option D: Operant conditioning.

Learn more about high anxiety from

https://brainly.com/question/13267543

#SPJ1

See full question below

Which procedure is being applied in the follow-up study of children who displayed high anxiety symptoms?

A. Extinction

B. Spontaneous recovery

C. Classical conditioning

D. Operant conditioning

flvs hope 01.01 answers for exams

Answers

FLVS hope 01.01 answers for exams importance of Physical Activity.

FLVS hope

Each segment of FLVS HOPE for online students is worth a half credit, and when both segments are finished, the student receives one full credit. On the FLVS HOPE website, it is said that students "enjoy the many benefits of physical activity, healthy nutrition, and sound decision making." It should take 32 to 36 weeks to complete. 9th grader Casey Stephany said that she is presently enrolled in FLVS HOPE. When asked how she enjoyed it, she responded, "I feel like it's a waste of time, therefore I don't really like it." Health and physical education are both part of FLVS HOPE. Students read books on health on Mondays and Thursdays. Students exercise physically on Tuesdays and Fridays by jogging, walking the track, or running uphill.

flvs hope 01.01 answers for exams

Learn more about FLVS hope here:

https://brainly.com/question/17465196

#SPJ1

A person should not drink alcohol when they are feeling all of the following except

Answers

Alcohol and anti-inflammatories: Increase the risk of gastric ulcer and bleeding.

Alcohol and antidepressants: Increase adverse reactions and sedative effect, in addition to decreasing the effectiveness of antidepressants.

What is alcohol interaction?

When alcohol reinforces or inhibits the effects of other drugs, acting at different sites and by different mechanisms

example:

synergy of the effects of central nervous system depressantssuch as sedativesopioidsgeneral anestheticsetc.

With this information, we can conclude that Alcoholic beverages and antidepressant medications can be a dangerous combination. That's because alcohol can make symptoms of depression worse.

Learn more about alcohol interaction in brainly.com/question/13292357

#SPJ1

Phs policy ______________ an occupational health and safety program for phs-assured institutions.

Answers

The PHS policy is set of standards administered for an occupational health and safety program for phs-assured institutions.

What is PHS policy?

PHS is an acronym that stands for  Public Health Service Policy.

The Public Health Service Policy on Humane Care and Use of Laboratory Animals (PHS Policy), is a set of standards administered by the Office of Laboratory Animal Welfare that require institutions to establish and maintain proper measures to ensure the appropriate care and use of all vertebrate animals involved.

The PHS policy requires institutions to use the Guide for the Care and Use of Laboratory Animals as a basis for developing and implementing an institutional program for activities involving animals.

Thus, the PHS policy is set of standards administered for an occupational health and safety program for phs-assured institutions.

Learn more about PHS policy here: https://brainly.com/question/14454719

#SPJ1

How can teeth be kept healthy?
Choose exactly 3 answers that are correct
brushing teeth
O rinsing with a mouthwash that contains plaque
flossing teeth
visling the dentist regularly

Answers

Answer:

- Brushing teeth

- Flossing teeth

- Visiting the dentist regularly

Explanation:

Mouthwash with plaque doesn't exist. Plaque is what builds up on your teeth that needs to be brushed away

Flossing teeth, brushing your teeth, and visting the dentist regularly

Can You eat cough drop with permanent bonded retainer ?

Answers

Explanation:

Avoid biting or chewing on cough drops, as they can break brackets or crack your aligners and even your teeth.

As long as you don't chew it and just let it desolve on your tongue away from the retainer, you should be okay.

An individual alcohol treatment program is most likely to be sought out by __________. a. the family of the person with the alcohol problem b. the individual with the alcohol problem c. local government officials d. police and corrections officers please select the best answer from the choices provided. a b c d

Answers

An individual alcohol treatment program is most likely to be sought out by the individual with the alcohol problem (Option b).

What is alcohol addiction?

Alcohol addiction refers to the situation where an individual is unable to control alcohol consumption because it is an addictive drug.

The people who suffer from alcohol addiction need to identify suitable programs who provide physiological support and suitable treatments.

In conclusion, an individual alcohol treatment program is most likely to be sought out by the individual with the alcohol problem (Option b).

Learn more about alcohol abuse here:

https://brainly.com/question/5851849

#SPJ1

Blood returns to the heart via the _____

Answers

Answer:

pulmonary veins

Explanation:

Fatima knows that she needs to consume more antioxidants. what would be the best breakfast to accomplish this? question 4 options: a bowl of cereal with milk a berry smoothie with kale egg whites and turkey bacon a cup of coffee and a breakfast pastry

Answers

Answer: I believe the answer would be eggs with bacon because eggs have a lot of antioxidants.

Answer:

a berry smoothie with kale.

Explanation:

A woman is seen in the emergency department in a severe state of anxiety following assault and battery. Which nursing action should the nurse place highest priority on at this time?

Answers

Severe nursing action should the nurse place the highest priority on at this time.

A few people locate complementary and alternative cures beneficial to control pressure and other common symptoms of mental health troubles. those can encompass things like yoga, meditation, aromatherapy, hypnotherapy, natural remedies, and acupuncture.

Most studies suggest that for major mental health disorders, a treatment approach involving both drugs and psychotherapy is more effective than either treatment method used alone. Psychiatrists are not the only mental health care practitioners trained to treat mental illness.

A few humans find complementary and alternative treatment plans useful to control stress and other commonplace signs of mental health troubles. these can consist of such things as yoga, meditation, aromatherapy, hypnotherapy, herbal treatments, and acupuncture.

Learn more about Psychiatrists here: https://brainly.com/question/12011520

#SPJ4

Which of the following lists the
stages of development from smallest to
largest?
R. zygote, fetus, embryo, child
s. fetus, infant, adolescent, child
T. embryo, fetus, infant, adolescent
v. fetus, embryo, zygote, infant

Answers

Answer:

s. fetus, infant, adolescent, child

The correct answer would be T!

Elden grows wheat on his land. However, his wheat farm is on a steep slope and hence more prone to soil erosion.

Answers

Answer:

Yes.

Explanation:

Yes, its field is more prone to soil erosion because the steep is sloppy and when the water comes to lower, it brought soil particles with them. So reduce erosion on these sloppy lands, contour type of farming should be used in order to avoid soil erosion. Terraces should be build on these steep slopes in order to reduce the speed of flowing water and prevent erosion.

Heros portrayed in moves, on televisions, and in video games always serve as good role models

Answers

False. Heros often time promote violence, (either that be in threats towards an enemy or be in actions).

Which indirect motor pathway has upper motor neurons that conduct impulses to skeletal muscles to the same side of the body?

Answers

I believe it is the Lateral Corticospinal Tract

To avoid injury, the intensity of your workout should be ________________ increased.

Answers

Answer: gradually?..

Explanation:

Which of the following eating disorders is characterized by eating dirt, clay or cigarette ashes
A.anorexia. B.atypical anorexia nervosa. C.pica. D.night eating disorder

Answers

Answer:

Pica

Explanation:

That would be pica! Pica causes you to impulsively eat things that are not actually food.

10 reasons why someone should live a physically active lifestyle.

Answers

Answer:

1. Feel more energized

2. Burn more calories at rest

3. Improve overall appearance

4. Be able to withstand stress

5. Decrease risk of illness

6. Speed up recovery from injury or surgery

7. Keep focused

8. Build up cardiovascular endurance

9. Improve flexibility

10. Increase lean body mass

Explanation:

live a healthy life kids

Answer:

Feel more energized.

Burn more calories at rest.

Improve overall appearance.

Be able to withstand stress.

Decrease risk of illness.

Speed up recovery from injury or surgery.

Keep focused.

Build up cardiovascular endurance

Improve flexibility

Increase lean body mass

Explanation:

:)

Problem-focused coping strategies include
Group of answer choices

yoga.

ta’i chi chuan.

meditation.

avoiding procrastination.

Answers

Problem-focused coping strategies include avoiding procrastination.

avoiding procrastination

What is procrastination and how to avoid it?

It is understood by procrastinating the act of putting off and putting off urgent tasks for later, even with the awareness that these are important actions. Keep in mind: you need to avoid procrastination to be successful.

With this information, we can conclude that when procastinating becomes a habit, it brings a lot of frustration in life, and can even trigger health problems such as stress and anxiety.

Learn more about procrastination in brainly.com/question/533589

#SPJ1

During adolescence, most teens develop the ability to
select one:
a. understand different points of view.
b. anticipate consequences.
c. think logically.
d. all of the above.

Answers

During adolescence, most teens develop the ability to d) all of the above

Adolescence is the process in which a child develops into an adult. It is called as a Teenage. It involves Physical and Psychological development of the human body and mind that occurs during puberty to adulthood.

It is usually the year between 10 to 19 years.

Understanding different point of views, Anticipating consequences and Thinking logically are definitely the key aspects involved during the Adolescence.

Following are the characteristics of the adolescence period:

Thinking logicallySearch for selfSelf-consciousnessAnticipating the consequencesUnderstanding different points of view Biological growthDevelopment in all aspectsLearning through success and failuresMultiple transformationsEmotional changesCuriosity to try different thingsSocializing

Learn more about Adolescence here, https://brainly.com/question/9506316

#SPJ1

What aspect of the run chart helps you compare data before and after a pdsa cycle?

Answers

The initial median AND the annotations of the tests for particular alterations (PDSA cycles) You can compare observations made before and after your PDSA cycle using the median and annotations denoting particular changes.

Changes may not result in improvement or even be practical in practice without adequate testing. Changes can ultimately be made easier to execute and more sustainable by employing Plan-Do-Act-Study (PDSA) cycles in testing.

Testing fosters a stronger belief that a change will lead to advancement PDSA cycles have a track record of gradually growing success for improved and modified ideas Testing gives you more time to adjust to local conditionsDetermine whether the adjustment needs to be adjusted to handle those adverse effects using PDSA cycles and testing

To learn more about PDSA click here

brainly.com/question/27974969

#SPJ4

Which means the loss of consciousness that occurs when the body cannot get the oxygen it needs to function?

Answers

Answer:

Asphyxiation

Explanation:

Which describes a psychiatrist?
A.
specialist who studies behavior and emotions, but can't prescribe medication
B.
specialist in diagnosing and treating mental health conditions and can prescribe medication
C.
specialist working primarily with the family members of someone in psychiatric care

Answers

Answer:

i think it might be A........

Answer:

B.

Explanation:

A psychiatrist is a specialist in diagnosing and treating mental health conditions and can prescribe medication.


I hope this helps! Have a great day!

Pan~

After completing a fitness evaluation, what steps should you take to improve your performance?

Answers

Answer:

After completing a fitness evaluation, you should review your results, create challenging goals, create a personal training plan, and reevaluate your goals once you've reached the end of the plan.

Explanation:

Reviewing your findings after a fitness exam can help you set ambitious goals, develop a customised training schedule, and reassess your objectives after the schedule is complete.

What is fitness?

Fitness is defined as the capacity to carry out everyday tasks with maximum efficiency, strength, and endurance while managing illness, weariness, and stress and reducing inactive behaviour.

One of the most crucial things you can do for your health is to exercise regularly. Physical activity may strengthen your bones and muscles, help you maintain a healthy weight, increase your ability to carry out daily tasks, and improve your cognitive health.

Reviewing your findings after a fitness exam can help you set ambitious goals, develop a customised training schedule, and reassess your objectives after the schedule is complete.

Learn more about fitness, here:

https://brainly.com/question/28919330

#SPJ5

PLEASE ANSWER QUICK.
According to the following passage, what is it called when you need more energy to survive?

“Most people realize that the food they eat leads to the energy they use when they jog, bike ride, or play sports. Humans need energy just to exist. Health practitioners call this the basal metabolic rate or BMR. A person’s BMR is the measure of the amount of energy that person needs at rest, without doing any other tasks and without digesting food. If a person is described as having a high metabolism, that person needs more energy to just stay alive. This person’s basal metabolic rate then is relatively high. A person that needs less energy to just stay alive has a lower basal metabolic rate and is said to have a low metabolism.”

Question 1 options:

High Metabolism


Low Metabolism


Basal Metabolic Rate


BMR

Answers

High metabolism:

If a person is described as having a high metabolism, that person needs more energy to just stay alive.

Answer:

High Metabolism is the correct answer.

Explanation:

Which of the following is an example of a flat
bone?
A. sternum
B. tarsal
C. mandible
D. femur

Answers

Answer:

a

Explanation:

flat bones protects our internal organs

Answer: A.) Sternum

Explanation:  is an example of a flat

bone.

If computer and information science are foundational to nursing informatics, should computer and information literacy be a requirement in all nursing programs at all levels?

Answers

The answer to the above question is yes. If computer and information science are foundational to nursing informatics, then computer and information literacy should be a requirement in all nursing programs at all levels.

Both computer and information science as well as computer and information literacy should be a requirement in all the nursing programs at all the levels. In today's world, computers are becoming a key component of every organization's working system. As a result, the healthcare industry also makes use of it. It helps in maintaining records and data in a proper and professional way.

Learn more about computer here

https://brainly.com/question/21474169

#SPJ4

Which components of the female reproductive system are not physically connected?
Cervix and vagina
Cervix and uterus
Ovaries and fimbriae
Fimbriae and fallopian tubes

Answers

The cervix and the uterus are not physically connected.

The components of the female reproductive system that are not physically connected are Cervix and uterus. Thus, the correct option for this question is B.

What is the function of the female reproductive system?

The function of the female reproductive system is to produce female sex cells and transport these cells to the site where they are successfully fertilized by sperm. It also provides a favorable environment for the developing fetus.

Cervix is the narrow passage at the opening of the place. The Uterus is the part where a baby grows and develops. Both of these components are not physically connected to one another. While the rest options of the components are significantly connected to each other physically.

Therefore, the cervix and uterus are the components of the female reproductive system that are not physically connected. Thus, the correct option for this question is B.

To learn more about the female reproductive system, refer to the link:

https://brainly.com/question/24153226

#SPJ2

what muscles do you use when making a bed ?

Answers

Answer:

Arms Legs Feet

Hope this helps :)

To save time, we often count the pulse for 30 seconds instead of a minute. If we
If we
do this, what must we multiply by to obtain an accurate pulse rate?
only count for 15 seconds, what do we multiply by?

Answers

Answer:

A. 2 B. 4

Explanation:

30 * 2 = 60

15 * 4 = 60

Outlining is a skill that will help you to study your textbook more carefully and to prepare more completely for your tests. When you read a chapter in your textbook, do not just read it. Read and outline it. Outlining is an organizational skill that develops your ability to think in a clear and logical manner. Some of the skills needed to outline are: understanding the relationship between headings and subheadings, identifying main ideas and supporting details, and understanding how to use the outline form.
One very effective way to outline an article that has headings and/or subheadings is to turn those headings into questions to be answered. Use the outline form to answer these questions, and you will then have the main points down on paper.(first image)

Here is an example. If the first heading in an article on dieting was “Foods to Avoid”, you could turn that into a question and put it into the outline.(second image)

In A and B above you would probably place answers to the question about what foods to avoid. Underneath it you would list reasons why you should avoid those foods, using the fewest words possible.
You have practiced using the correct outlining form. You know that headings and subheadings can be used as part of the skeleton in your outline. You also know that finding the main idea of a paragraph can be done by turning the headings or subheadings into a question. The answer is usually the main idea.
It will take some practice with these skills to feel completely comfortable using them on a regular basis. At first it will seem like outlining a chapter in your textbook will take too long to be helpful. If you practice enough, you will get faster at outlining and more comfortable with the process. Then you will see that outlining actually speeds up the time it takes you to read and study a chapter.
There is an outline on the next page which you will use to create your outline. Please remember to follow the guidelines explained to you over the last two pages. Feel free to add on to the outline form if necessary.

Answers

The second item that can be added in the given outline about dieting is:

What foods should you avoid?

Sweets

ReasonsIt contains unwanted and unhealthy caloriesCan lead to an increase in blood sugar levels

What is an Outline?

This refers to the general description of the main features of a text that helps a person think in a clear and logical manner.

Hence, we can see that based on your given outline, there is the topic of outline and the foods to avoid when dieting and the reasons why they should be avoided and the second part has been added.

Read more about outlines here:

https://brainly.com/question/966843

#SPJ1

Other Questions
6-5. (from the previous table) what is the largest amount of slack that any activity in the project has? group of answer choices a. 1 week b. 2 weeks c. 3 weeks d. 4 or more weeks ________ featured twelve-bar blues progressions and ""boogie"" rhythms while incorporating musical elements common to country music. the fan blades on a jet engine have a moment of inertia 30.0 kg-m 2 . in 10 s, they rotate counterclockwise from rest up to a rotation rate of 20 rev/s. a). What torque must be applied to the blades to achieve this angular acceleration?b). What is the torque required to bring the fan blades rotating at 20 rev/s to a rest in 20 s? the chemical analysis of a macromolecule has been provided. what is this macromolecule? It is known that amounts of money spent on textbooks in a year by students follow a normal distribution with mean $400 and standard deviation $50. Find the shortest range of dollar spending on textbooks in a year that includes 60% of all students. Choose the example that is punctuated correctly.I am writing a report with a coworker. Because we are going to use the criteria organization method we have to examine each plan by the same standard.I am writing a report with a coworker. Because we are going to use the criteria organization method, we have to examine each plan by the same standard.I am writing a report with a coworker because we are going to use the criteria organization method, we have to examine each plan by the same standard. Fantasy essay 200 words Calculate the ph of a solution containing 20 ml of 0.001 m hcl and 0.5 ml of 0.04 m sodium acetate. give the answer in two sig figs. 20 pts) determine the moment of f = {300i 150j 300k} n about the x axis using the dot and cross products. A force F of 10 N is applied in the direction indicated, per meter depth (into page). The 300 mm long triangular beam is Aluminum, 1100 series, and extends 2 meters into the page. What is the moment about point A, per meter of depth? The system is on Earth, at sea level, gravity acts in the direction of F.Note: The centroid of a triangle is located at h/3.A) 16 Nm/mB) 19 Nm/mC) 24 Nm/mD) 27 Nm/m What is the measurement of N? it is common for a developer to hold back funds before making final payment to ensure that subcontractors perform all work completely. group startstrue or false a 75 year old patient is complaining of shortness of breath. vital signs are bp 160/88, p 130, and r 22 with crackles in the bases of the lungs. you should A client who is anticipating total hip replacement is considering autologous transfusion. When teaching this client about autologous transfusion, it is important to emphasize that?-It reduces the risk of mismatched blood-A hemoglobin level above 9.5 mg/dL is required-there is no need to test the blood for infectious diseases-Donations may be made every other day PWEEZ helpBased on the results of the second simulation, if 224 groups are formed, about how many of them would you expect to contain all girls? Round your answer to the nearest number of groups true/false. the number of levels of observed x-values must be equal to the order of the polynomial in x that you want to fit. If the Watson strand for a double stranded DNA is 5 ATGGTCATGGGTTCCAATGCA 3, what is the sequence of the Crick strand? Find the center of mass of a thin triangular plate bounded by the coordinate axes and the line x + y = 9 if (x,y) = x + y. A)x=2,y=2B) x=54,y=54C)x=98,y=98D)x=1,y=1 Assuming the medium fertility variant, which group of countries will have a decrease in population by 2100, compared to 2015 levels? Choose all that apply.1. Low-income countries2. Lower-middle-income countries3. Upper-middle-income countries4. None of the groups of countries will decrease. A triangle has a side lengths of 21 miles, 28 miles, and 35 miles. Is it a right triangle?